Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013769802:

Variant ID: vg1013769802 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 13769802
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, G: 0.09, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

TAATCACATCATGCAGCTGCTGCAGGAAGCGCAGATGGAGTAAGTCCCAACTACAGCAGGCGTATCTCTTGCTGATCTGTTGCATCTGCGTGCTTCTTCT[A/G]
ATTAATCCACCTGTGATTTCTCTCTGAACTCGATCAATCTTTGTTTTTCTTTGAGAAGAAACTTTTTTCCTCCAGGGATATCGACAAATTAGCTGTAAAC

Reverse complement sequence

GTTTACAGCTAATTTGTCGATATCCCTGGAGGAAAAAAGTTTCTTCTCAAAGAAAAACAAAGATTGATCGAGTTCAGAGAGAAATCACAGGTGGATTAAT[T/C]
AGAAGAAGCACGCAGATGCAACAGATCAGCAAGAGATACGCCTGCTGTAGTTGGGACTTACTCCATCTGCGCTTCCTGCAGCAGCTGCATGATGTGATTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.20%	20.80%	0.00%	0.00%	NA
All Indica	2759	98.10%	1.90%	0.00%	0.00%	NA
All Japonica	1512	61.90%	38.10%	0.00%	0.00%	NA
Aus	269	9.30%	90.70%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	97.50%	2.50%	0.00%	0.00%	NA
Indica Intermediate	786	96.90%	3.10%	0.00%	0.00%	NA
Temperate Japonica	767	93.70%	6.30%	0.00%	0.00%	NA
Tropical Japonica	504	26.40%	73.60%	0.00%	0.00%	NA
Japonica Intermediate	241	34.90%	65.10%	0.00%	0.00%	NA
VI/Aromatic	96	9.40%	90.60%	0.00%	0.00%	NA
Intermediate	90	75.60%	24.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1013769802	A -> G	LOC_Os10g26440.1	upstream_gene_variant ; 4131.0bp to feature; MODIFIER	silent_mutation	Average:44.096; most accessible tissue: Callus, score: 80.367	N	N	N	N
vg1013769802	A -> G	LOC_Os10g26460.1	upstream_gene_variant ; 3915.0bp to feature; MODIFIER	silent_mutation	Average:44.096; most accessible tissue: Callus, score: 80.367	N	N	N	N
vg1013769802	A -> G	LOC_Os10g26450.1	downstream_gene_variant ; 3138.0bp to feature; MODIFIER	silent_mutation	Average:44.096; most accessible tissue: Callus, score: 80.367	N	N	N	N
vg1013769802	A -> G	LOC_Os10g26450-LOC_Os10g26460	intergenic_region ; MODIFIER	silent_mutation	Average:44.096; most accessible tissue: Callus, score: 80.367	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1013769802	NA	8.88E-15	Grain_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1013769802	NA	1.31E-07	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013769802	NA	7.98E-10	mr1178	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013769802	NA	5.31E-06	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013769802	NA	6.17E-07	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013769802	2.24E-08	NA	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013769802	9.88E-08	5.77E-17	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013769802	NA	2.65E-08	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013769802	NA	1.33E-07	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013769802	NA	4.43E-12	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013769802	NA	2.43E-07	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013769802	NA	2.48E-14	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013769802	NA	6.53E-08	mr1916	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013769802	2.35E-08	NA	mr1980	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013769802	2.25E-06	1.30E-18	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013769802	NA	4.70E-10	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013769802	NA	2.99E-08	mr1156_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013769802	NA	1.81E-12	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013769802	1.17E-06	NA	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013769802	1.24E-06	6.40E-21	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013769802	NA	4.31E-15	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013769802	NA	1.15E-07	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013769802	NA	1.88E-07	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013769802	NA	2.45E-14	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013769802	NA	1.90E-09	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013769802	2.15E-06	NA	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013769802	NA	6.64E-11	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251