\
| Variant ID: vg1013768895 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13768895 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, A: 0.06, others allele: 0.00, population size: 186. )
ATGGATCGGAGGAAAGGGAGTAGTAATTATATATGAATTTATCATGTAGCAAAAAACCGTACCATACATTTTGAAACAACTGATTGTTTCCTATCCATTC[C/A]
TACGAAATTCCATTATAATGGTCCATTCTAGTGTAATATTGGAGGAAAAAAAGTATGAAGTCTTACCTCATGTTTTTCTCTTTACGTGTCTATGAATCCT
AGGATTCATAGACACGTAAAGAGAAAAACATGAGGTAAGACTTCATACTTTTTTTCCTCCAATATTACACTAGAATGGACCATTATAATGGAATTTCGTA[G/T]
GAATGGATAGGAAACAATCAGTTGTTTCAAAATGTATGGTACGGTTTTTTGCTACATGATAAATTCATATATAATTACTACTCCCTTTCCTCCGATCCAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.00% | 21.00% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 61.80% | 38.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 9.70% | 90.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 93.70% | 6.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 26.60% | 73.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 33.60% | 66.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013768895 | C -> A | LOC_Os10g26440.1 | upstream_gene_variant ; 3224.0bp to feature; MODIFIER | silent_mutation | Average:31.355; most accessible tissue: Zhenshan97 young leaf, score: 50.0 | N | N | N | N |
| vg1013768895 | C -> A | LOC_Os10g26460.1 | upstream_gene_variant ; 4822.0bp to feature; MODIFIER | silent_mutation | Average:31.355; most accessible tissue: Zhenshan97 young leaf, score: 50.0 | N | N | N | N |
| vg1013768895 | C -> A | LOC_Os10g26450.1 | downstream_gene_variant ; 2231.0bp to feature; MODIFIER | silent_mutation | Average:31.355; most accessible tissue: Zhenshan97 young leaf, score: 50.0 | N | N | N | N |
| vg1013768895 | C -> A | LOC_Os10g26450-LOC_Os10g26460 | intergenic_region ; MODIFIER | silent_mutation | Average:31.355; most accessible tissue: Zhenshan97 young leaf, score: 50.0 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013768895 | NA | 8.11E-16 | Grain_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1013768895 | NA | 1.26E-07 | mr1022 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013768895 | NA | 1.12E-06 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013768895 | NA | 7.91E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013768895 | 2.57E-08 | NA | mr1533 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013768895 | 1.15E-07 | 1.24E-16 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013768895 | NA | 1.86E-08 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013768895 | NA | 8.96E-11 | mr1696 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013768895 | NA | 7.79E-07 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013768895 | NA | 3.83E-15 | mr1916 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013768895 | NA | 5.01E-08 | mr1916 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013768895 | 5.41E-08 | NA | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013768895 | 4.08E-06 | 8.66E-18 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013768895 | NA | 8.95E-09 | mr1156_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013768895 | NA | 3.50E-12 | mr1189_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013768895 | NA | 1.21E-09 | mr1338_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013768895 | 4.86E-09 | NA | mr1533_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013768895 | 1.52E-09 | 4.97E-24 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013768895 | NA | 4.45E-16 | mr1552_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013768895 | NA | 7.00E-10 | mr1552_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013768895 | 3.79E-08 | NA | mr1980_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013768895 | 5.49E-07 | 8.07E-13 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |