\
| Variant ID: vg1013686061 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13686061 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.02, others allele: 0.00, population size: 117. )
ACCATCACCACTTGGGGTCAAGCGGCTATAGCGTTGCAATGCCGAAGTGGGAGGAGATGGAGGCAAGATTGATTGAGAGGGGTATCGAACCGGCCACCGC[T/C]
AAATGGCCGGATCGATCGAAGTTCTGGTACTATGCTCACGGCGGAACGCTTAACCCAGTTGATGGCTCCCTTGTCTTCAGCGATCAGATACGCGAGGCTG
CAGCCTCGCGTATCTGATCGCTGAAGACAAGGGAGCCATCAACTGGGTTAAGCGTTCCGCCGTGAGCATAGTACCAGAACTTCGATCGATCCGGCCATTT[A/G]
GCGGTGGCCGGTTCGATACCCCTCTCAATCAATCTTGCCTCCATCTCCTCCCACTTCGGCATTGCAACGCTATAGCCGCTTGACCCCAAGTGGTGATGGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.40% | 25.00% | 14.03% | 3.51% | NA |
| All Indica | 2759 | 29.20% | 41.40% | 23.49% | 5.87% | NA |
| All Japonica | 1512 | 99.30% | 0.50% | 0.26% | 0.00% | NA |
| Aus | 269 | 92.20% | 5.60% | 1.49% | 0.74% | NA |
| Indica I | 595 | 31.60% | 32.30% | 29.41% | 6.72% | NA |
| Indica II | 465 | 9.20% | 52.30% | 32.26% | 6.24% | NA |
| Indica III | 913 | 34.30% | 43.30% | 17.09% | 5.37% | NA |
| Indica Intermediate | 786 | 33.50% | 39.70% | 21.25% | 5.60% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 0.60% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.80% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 18.90% | 6.67% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013686061 | T -> C | LOC_Os10g26370.1 | synonymous_variant ; p.Ala1224Ala; LOW | synonymous_codon | Average:25.133; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg1013686061 | T -> DEL | LOC_Os10g26370.1 | N | frameshift_variant | Average:25.133; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013686061 | NA | 1.29E-09 | mr1457 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013686061 | NA | 1.40E-07 | mr1533 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013686061 | NA | 3.84E-07 | mr1980 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013686061 | 9.97E-10 | NA | mr1533_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013686061 | 1.29E-10 | 7.73E-16 | mr1533_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013686061 | NA | 3.79E-07 | mr1980_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |