Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013651285:

Variant ID: vg1013651285 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 13651285
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.79, C: 0.22, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

GGTAACGGGCGTTGTAGAGGAAGAATTGTTCGGAGATTCTCATATTTAGGGTTTACCCCTTGCAGCATGGCGAGGACGAGCTGCCGATCGGTGACAGGGT[T/C]
GCCGAGTTCGCTTTGTGTGTCCGCCATAGCTTTGAGGCGCCGGTAGTAGTCGTTGGCGGAGAGATCGCCTTGGAAGAAGTTGTGGAACTGCGCCGACAAG

Reverse complement sequence

CTTGTCGGCGCAGTTCCACAACTTCTTCCAAGGCGATCTCTCCGCCAACGACTACTACCGGCGCCTCAAAGCTATGGCGGACACACAAAGCGAACTCGGC[A/G]
ACCCTGTCACCGATCGGCAGCTCGTCCTCGCCATGCTGCAAGGGGTAAACCCTAAATATGAGAATCTCCGAACAATTCTTCCTCTACAACGCCCGTTACC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.10%	29.30%	1.50%	1.04%	NA
All Indica	2759	72.00%	25.20%	1.67%	1.12%	NA
All Japonica	1512	60.90%	39.00%	0.07%	0.00%	NA
Aus	269	82.90%	1.90%	8.55%	6.69%	NA
Indica I	595	68.90%	29.40%	0.67%	1.01%	NA
Indica II	465	93.30%	2.60%	2.58%	1.51%	NA
Indica III	913	65.30%	32.20%	1.42%	1.10%	NA
Indica Intermediate	786	69.60%	27.20%	2.16%	1.02%	NA
Temperate Japonica	767	93.70%	6.30%	0.00%	0.00%	NA
Tropical Japonica	504	18.80%	81.00%	0.20%	0.00%	NA
Japonica Intermediate	241	44.40%	55.60%	0.00%	0.00%	NA
VI/Aromatic	96	21.90%	78.10%	0.00%	0.00%	NA
Intermediate	90	74.40%	24.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1013651285	T -> C	LOC_Os10g26320.1	downstream_gene_variant ; 4532.0bp to feature; MODIFIER	silent_mutation	Average:77.239; most accessible tissue: Minghui63 flag leaf, score: 89.997	N	N	N	N
vg1013651285	T -> C	LOC_Os10g26330.1	intron_variant ; MODIFIER	silent_mutation	Average:77.239; most accessible tissue: Minghui63 flag leaf, score: 89.997	N	N	N	N
vg1013651285	T -> DEL	N	N	silent_mutation	Average:77.239; most accessible tissue: Minghui63 flag leaf, score: 89.997	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1013651285	NA	3.37E-15	Grain_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1013651285	5.11E-06	NA	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285	3.14E-19	4.80E-24	mr1533	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285	NA	1.79E-11	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285	NA	8.09E-07	mr1739	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285	2.50E-06	NA	mr1980	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285	8.93E-19	4.35E-23	mr1980	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285	NA	6.42E-13	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285	NA	1.51E-06	mr1224_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285	6.25E-20	6.04E-30	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285	4.70E-08	8.44E-22	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285	NA	2.74E-10	mr1552_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285	NA	7.63E-08	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285	NA	1.99E-06	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285	1.42E-07	6.47E-12	mr1980_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285	NA	1.65E-10	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251