\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013651285:

Variant ID: vg1013651285 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13651285
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.79, C: 0.22, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


GGTAACGGGCGTTGTAGAGGAAGAATTGTTCGGAGATTCTCATATTTAGGGTTTACCCCTTGCAGCATGGCGAGGACGAGCTGCCGATCGGTGACAGGGT[T/C]
GCCGAGTTCGCTTTGTGTGTCCGCCATAGCTTTGAGGCGCCGGTAGTAGTCGTTGGCGGAGAGATCGCCTTGGAAGAAGTTGTGGAACTGCGCCGACAAG

Reverse complement sequence

CTTGTCGGCGCAGTTCCACAACTTCTTCCAAGGCGATCTCTCCGCCAACGACTACTACCGGCGCCTCAAAGCTATGGCGGACACACAAAGCGAACTCGGC[A/G]
ACCCTGTCACCGATCGGCAGCTCGTCCTCGCCATGCTGCAAGGGGTAAACCCTAAATATGAGAATCTCCGAACAATTCTTCCTCTACAACGCCCGTTACC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.10% 29.30% 1.50% 1.04% NA
All Indica  2759 72.00% 25.20% 1.67% 1.12% NA
All Japonica  1512 60.90% 39.00% 0.07% 0.00% NA
Aus  269 82.90% 1.90% 8.55% 6.69% NA
Indica I  595 68.90% 29.40% 0.67% 1.01% NA
Indica II  465 93.30% 2.60% 2.58% 1.51% NA
Indica III  913 65.30% 32.20% 1.42% 1.10% NA
Indica Intermediate  786 69.60% 27.20% 2.16% 1.02% NA
Temperate Japonica  767 93.70% 6.30% 0.00% 0.00% NA
Tropical Japonica  504 18.80% 81.00% 0.20% 0.00% NA
Japonica Intermediate  241 44.40% 55.60% 0.00% 0.00% NA
VI/Aromatic  96 21.90% 78.10% 0.00% 0.00% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013651285 T -> C LOC_Os10g26320.1 downstream_gene_variant ; 4532.0bp to feature; MODIFIER silent_mutation Average:77.239; most accessible tissue: Minghui63 flag leaf, score: 89.997 N N N N
vg1013651285 T -> C LOC_Os10g26330.1 intron_variant ; MODIFIER silent_mutation Average:77.239; most accessible tissue: Minghui63 flag leaf, score: 89.997 N N N N
vg1013651285 T -> DEL N N silent_mutation Average:77.239; most accessible tissue: Minghui63 flag leaf, score: 89.997 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013651285 NA 3.37E-15 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1013651285 5.11E-06 NA mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285 3.14E-19 4.80E-24 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285 NA 1.79E-11 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285 NA 8.09E-07 mr1739 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285 2.50E-06 NA mr1980 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285 8.93E-19 4.35E-23 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285 NA 6.42E-13 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285 NA 1.51E-06 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285 6.25E-20 6.04E-30 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285 4.70E-08 8.44E-22 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285 NA 2.74E-10 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285 NA 7.63E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285 NA 1.99E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285 1.42E-07 6.47E-12 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013651285 NA 1.65E-10 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251