\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013542818:

Variant ID: vg1013542818 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13542818
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GCATGCATCCAATAAAATTAAAGAGCTTGAGAGTGTATGATTTAAAAAAGTAATAATTTATTGAAGAAGTGGTCATAGTTAATTGCCTACATACATACAT[G/A]
TCTTATATTATAGAACATCTAAAAAAATAGTTGTGCCTTATATTATAGCATGGAGGGAGTAATAATCTAGAGAAACAAACAGCCAACAATTTATTCTATG

Reverse complement sequence

CATAGAATAAATTGTTGGCTGTTTGTTTCTCTAGATTATTACTCCCTCCATGCTATAATATAAGGCACAACTATTTTTTTAGATGTTCTATAATATAAGA[C/T]
ATGTATGTATGTAGGCAATTAACTATGACCACTTCTTCAATAAATTATTACTTTTTTAAATCATACACTCTCAAGCTCTTTAATTTTATTGGATGCATGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.90% 33.00% 0.04% 0.00% NA
All Indica  2759 97.30% 2.70% 0.00% 0.00% NA
All Japonica  1512 27.10% 72.80% 0.07% 0.00% NA
Aus  269 9.70% 90.30% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 95.30% 4.70% 0.00% 0.00% NA
Indica III  913 97.90% 2.10% 0.00% 0.00% NA
Indica Intermediate  786 95.70% 4.30% 0.00% 0.00% NA
Temperate Japonica  767 5.60% 94.40% 0.00% 0.00% NA
Tropical Japonica  504 51.40% 48.60% 0.00% 0.00% NA
Japonica Intermediate  241 44.80% 54.80% 0.41% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 46.70% 52.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013542818 G -> A LOC_Os10g26130.1 upstream_gene_variant ; 355.0bp to feature; MODIFIER silent_mutation Average:92.59; most accessible tissue: Zhenshan97 flag leaf, score: 95.2 N N N N
vg1013542818 G -> A LOC_Os10g26140.1 upstream_gene_variant ; 590.0bp to feature; MODIFIER silent_mutation Average:92.59; most accessible tissue: Zhenshan97 flag leaf, score: 95.2 N N N N
vg1013542818 G -> A LOC_Os10g26145.1 upstream_gene_variant ; 822.0bp to feature; MODIFIER silent_mutation Average:92.59; most accessible tissue: Zhenshan97 flag leaf, score: 95.2 N N N N
vg1013542818 G -> A LOC_Os10g26130.2 upstream_gene_variant ; 383.0bp to feature; MODIFIER silent_mutation Average:92.59; most accessible tissue: Zhenshan97 flag leaf, score: 95.2 N N N N
vg1013542818 G -> A LOC_Os10g26130.3 upstream_gene_variant ; 355.0bp to feature; MODIFIER silent_mutation Average:92.59; most accessible tissue: Zhenshan97 flag leaf, score: 95.2 N N N N
vg1013542818 G -> A LOC_Os10g26140.3 upstream_gene_variant ; 590.0bp to feature; MODIFIER silent_mutation Average:92.59; most accessible tissue: Zhenshan97 flag leaf, score: 95.2 N N N N
vg1013542818 G -> A LOC_Os10g26140.2 upstream_gene_variant ; 623.0bp to feature; MODIFIER silent_mutation Average:92.59; most accessible tissue: Zhenshan97 flag leaf, score: 95.2 N N N N
vg1013542818 G -> A LOC_Os10g26130-LOC_Os10g26140 intergenic_region ; MODIFIER silent_mutation Average:92.59; most accessible tissue: Zhenshan97 flag leaf, score: 95.2 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1013542818 G A 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013542818 NA 7.84E-17 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1013542818 NA 1.05E-20 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013542818 NA 8.86E-19 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013542818 NA 3.37E-08 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013542818 1.92E-07 NA mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013542818 1.89E-06 2.15E-14 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013542818 NA 3.31E-08 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013542818 4.07E-10 NA mr1980 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013542818 2.77E-08 2.49E-21 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013542818 NA 3.05E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013542818 NA 2.37E-22 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013542818 NA 4.81E-25 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013542818 3.54E-12 NA mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013542818 1.07E-09 1.33E-23 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013542818 NA 5.80E-09 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013542818 NA 2.55E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013542818 1.52E-07 NA mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013542818 NA 5.10E-09 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251