\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013528778:

Variant ID: vg1013528778 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13528778
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCTTATTTAACAATTAATTGGAACTCACCAACCGAAACTGATTCATTTAACTATGTATCTATTATATACTAAAAGTCCATTAAACTTTCTACAAACGCT[C/T]
CTAAACCGTCACATGGCATCCTATAAACGCTCCTAAGTCGTCAAGTGGCACTACAATTTAGAGAAATTTAGAATAAATCTCTAGCCATTGATTTTCATTA

Reverse complement sequence

TAATGAAAATCAATGGCTAGAGATTTATTCTAAATTTCTCTAAATTGTAGTGCCACTTGACGACTTAGGAGCGTTTATAGGATGCCATGTGACGGTTTAG[G/A]
AGCGTTTGTAGAAAGTTTAATGGACTTTTAGTATATAATAGATACATAGTTAAATGAATCAGTTTCGGTTGGTGAGTTCCAATTAATTGTTAAATAAGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.70% 7.80% 0.08% 0.47% NA
All Indica  2759 99.90% 0.00% 0.00% 0.07% NA
All Japonica  1512 74.70% 23.70% 0.26% 1.32% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.10% 0.00% 0.25% NA
Temperate Japonica  767 94.90% 4.70% 0.13% 0.26% NA
Tropical Japonica  504 51.40% 47.00% 0.20% 1.39% NA
Japonica Intermediate  241 59.30% 35.30% 0.83% 4.56% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013528778 C -> T LOC_Os10g26110.1 upstream_gene_variant ; 2853.0bp to feature; MODIFIER silent_mutation Average:65.297; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg1013528778 C -> T LOC_Os10g26110-LOC_Os10g26130 intergenic_region ; MODIFIER silent_mutation Average:65.297; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg1013528778 C -> DEL N N silent_mutation Average:65.297; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013528778 NA 3.45E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1013528778 NA 4.87E-07 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528778 7.60E-06 7.21E-20 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528778 3.18E-06 3.92E-15 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528778 NA 1.02E-11 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528778 4.00E-09 NA mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528778 2.40E-08 4.19E-16 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528778 NA 5.58E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528778 NA 4.50E-30 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528778 NA 1.09E-12 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528778 1.60E-15 NA mr1980 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528778 1.03E-12 1.08E-26 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528778 NA 1.59E-19 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528778 3.39E-06 1.49E-16 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528778 NA 6.23E-12 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528778 3.37E-10 NA mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528778 1.21E-08 8.88E-23 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528778 NA 4.18E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013528778 NA 3.14E-08 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251