Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013513655:

Variant ID: vg1013513655 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 13513655
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.53, T: 0.47, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

ATTCATCACTAGCACAAGTCATCATATGTAGACATTAGCATCTAAACATTGAATCAACAAATAATCGCACTATCACATTATCGAATTTAAACATTATCAT[T/C]
GAATCATAGAATCATCACATATAACATGTACACAGCAAATCATCACATTATGCATCATCATCGGTGAGGAGTACCTACCTTGCACGGTGGCGAGCTCGGT

Reverse complement sequence

ACCGAGCTCGCCACCGTGCAAGGTAGGTACTCCTCACCGATGATGATGCATAATGTGATGATTTGCTGTGTACATGTTATATGTGATGATTCTATGATTC[A/G]
ATGATAATGTTTAAATTCGATAATGTGATAGTGCGATTATTTGTTGATTCAATGTTTAGATGCTAATGTCTACATATGATGACTTGTGCTAGTGATGAAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.50%	0.20%	4.51%	2.77%	NA
All Indica	2759	92.30%	0.10%	3.62%	3.95%	NA
All Japonica	1512	93.30%	0.10%	5.22%	1.39%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	95.10%	0.00%	2.86%	2.02%	NA
Indica II	465	83.70%	0.00%	5.59%	10.75%	NA
Indica III	913	96.60%	0.20%	1.75%	1.42%	NA
Indica Intermediate	786	90.20%	0.30%	5.22%	4.33%	NA
Temperate Japonica	767	98.60%	0.00%	0.52%	0.91%	NA
Tropical Japonica	504	88.90%	0.20%	8.53%	2.38%	NA
Japonica Intermediate	241	85.90%	0.00%	13.28%	0.83%	NA
VI/Aromatic	96	64.60%	5.20%	30.21%	0.00%	NA
Intermediate	90	93.30%	0.00%	5.56%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1013513655	T -> C	LOC_Os10g26080.1	upstream_gene_variant ; 2398.0bp to feature; MODIFIER	silent_mutation	Average:39.974; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg1013513655	T -> C	LOC_Os10g26090.1	downstream_gene_variant ; 1208.0bp to feature; MODIFIER	silent_mutation	Average:39.974; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg1013513655	T -> C	LOC_Os10g26080-LOC_Os10g26090	intergenic_region ; MODIFIER	silent_mutation	Average:39.974; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg1013513655	T -> DEL	N	N	silent_mutation	Average:39.974; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1013513655	NA	6.81E-09	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655	NA	2.78E-07	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655	NA	1.27E-09	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655	NA	1.12E-21	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655	3.86E-07	NA	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655	NA	7.08E-15	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655	NA	4.00E-10	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655	NA	1.08E-07	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655	NA	5.91E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655	NA	1.82E-14	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655	NA	4.10E-07	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655	NA	8.34E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655	3.41E-15	9.65E-52	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655	3.11E-13	4.59E-22	mr1533	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655	NA	6.68E-06	mr1578	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655	NA	2.90E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655	NA	2.35E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655	NA	2.81E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655	3.53E-14	2.42E-47	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655	6.43E-08	6.38E-22	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655	NA	2.08E-18	mr1156_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655	NA	2.91E-08	mr1156_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655	8.74E-13	2.49E-51	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655	2.87E-07	2.43E-20	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655	7.64E-09	5.10E-25	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655	NA	4.12E-09	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251