\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013513655:

Variant ID: vg1013513655 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13513655
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.53, T: 0.47, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCATCACTAGCACAAGTCATCATATGTAGACATTAGCATCTAAACATTGAATCAACAAATAATCGCACTATCACATTATCGAATTTAAACATTATCAT[T/C]
GAATCATAGAATCATCACATATAACATGTACACAGCAAATCATCACATTATGCATCATCATCGGTGAGGAGTACCTACCTTGCACGGTGGCGAGCTCGGT

Reverse complement sequence

ACCGAGCTCGCCACCGTGCAAGGTAGGTACTCCTCACCGATGATGATGCATAATGTGATGATTTGCTGTGTACATGTTATATGTGATGATTCTATGATTC[A/G]
ATGATAATGTTTAAATTCGATAATGTGATAGTGCGATTATTTGTTGATTCAATGTTTAGATGCTAATGTCTACATATGATGACTTGTGCTAGTGATGAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.50% 0.20% 4.51% 2.77% NA
All Indica  2759 92.30% 0.10% 3.62% 3.95% NA
All Japonica  1512 93.30% 0.10% 5.22% 1.39% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 95.10% 0.00% 2.86% 2.02% NA
Indica II  465 83.70% 0.00% 5.59% 10.75% NA
Indica III  913 96.60% 0.20% 1.75% 1.42% NA
Indica Intermediate  786 90.20% 0.30% 5.22% 4.33% NA
Temperate Japonica  767 98.60% 0.00% 0.52% 0.91% NA
Tropical Japonica  504 88.90% 0.20% 8.53% 2.38% NA
Japonica Intermediate  241 85.90% 0.00% 13.28% 0.83% NA
VI/Aromatic  96 64.60% 5.20% 30.21% 0.00% NA
Intermediate  90 93.30% 0.00% 5.56% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013513655 T -> C LOC_Os10g26080.1 upstream_gene_variant ; 2398.0bp to feature; MODIFIER silent_mutation Average:39.974; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg1013513655 T -> C LOC_Os10g26090.1 downstream_gene_variant ; 1208.0bp to feature; MODIFIER silent_mutation Average:39.974; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg1013513655 T -> C LOC_Os10g26080-LOC_Os10g26090 intergenic_region ; MODIFIER silent_mutation Average:39.974; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg1013513655 T -> DEL N N silent_mutation Average:39.974; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013513655 NA 6.81E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655 NA 2.78E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655 NA 1.27E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655 NA 1.12E-21 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655 3.86E-07 NA mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655 NA 7.08E-15 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655 NA 4.00E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655 NA 1.08E-07 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655 NA 5.91E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655 NA 1.82E-14 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655 NA 4.10E-07 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655 NA 8.34E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655 3.41E-15 9.65E-52 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655 3.11E-13 4.59E-22 mr1533 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655 NA 6.68E-06 mr1578 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655 NA 2.90E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655 NA 2.35E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655 NA 2.81E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655 3.53E-14 2.42E-47 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655 6.43E-08 6.38E-22 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655 NA 2.08E-18 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655 NA 2.91E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655 8.74E-13 2.49E-51 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655 2.87E-07 2.43E-20 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655 7.64E-09 5.10E-25 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013513655 NA 4.12E-09 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251