\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013390665:

Variant ID: vg1013390665 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13390665
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.59, T: 0.41, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


GCGGGAAATTCGGTTTTGTTTCGTTTTGGAAACATTCCGAAAAATCCGGTGCGTGAAAATGGCGTGAAGTCCGGATAAATTATGCGCGACTTATCCGGTT[T/C]
GGTTACGTGGAGTGGAGATCGTGCGGACGCCCTGATCAAGCGACCTATCTCTACATAAACCGAGCCGCCGCCTTCACGCAACACACGCGAAATCAATCAT

Reverse complement sequence

ATGATTGATTTCGCGTGTGTTGCGTGAAGGCGGCGGCTCGGTTTATGTAGAGATAGGTCGCTTGATCAGGGCGTCCGCACGATCTCCACTCCACGTAACC[A/G]
AACCGGATAAGTCGCGCATAATTTATCCGGACTTCACGCCATTTTCACGCACCGGATTTTTCGGAATGTTTCCAAAACGAAACAAAACCGAATTTCCCGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.20% 30.60% 1.29% 0.00% NA
All Indica  2759 86.70% 11.10% 2.14% 0.00% NA
All Japonica  1512 32.40% 67.60% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 90.80% 5.20% 4.03% 0.00% NA
Indica II  465 94.40% 3.40% 2.15% 0.00% NA
Indica III  913 84.00% 15.80% 0.22% 0.00% NA
Indica Intermediate  786 82.30% 14.80% 2.93% 0.00% NA
Temperate Japonica  767 5.90% 94.10% 0.00% 0.00% NA
Tropical Japonica  504 65.90% 34.10% 0.00% 0.00% NA
Japonica Intermediate  241 46.90% 53.10% 0.00% 0.00% NA
VI/Aromatic  96 20.80% 79.20% 0.00% 0.00% NA
Intermediate  90 55.60% 42.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013390665 T -> C LOC_Os10g25830.1 upstream_gene_variant ; 1862.0bp to feature; MODIFIER silent_mutation Average:58.719; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg1013390665 T -> C LOC_Os10g25850.1 upstream_gene_variant ; 2240.0bp to feature; MODIFIER silent_mutation Average:58.719; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg1013390665 T -> C LOC_Os10g25830-LOC_Os10g25850 intergenic_region ; MODIFIER silent_mutation Average:58.719; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013390665 NA 3.19E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665 4.97E-06 NA mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665 NA 5.24E-14 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665 NA 5.59E-16 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665 5.04E-06 1.82E-09 mr1424 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665 2.56E-07 2.60E-37 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665 1.13E-12 5.80E-22 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665 NA 2.52E-07 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665 6.30E-07 8.97E-33 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665 2.92E-11 2.61E-26 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665 NA 4.82E-18 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665 NA 9.09E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665 NA 3.12E-15 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665 5.26E-09 2.85E-38 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665 3.27E-14 1.49E-29 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665 NA 7.22E-08 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665 8.39E-07 1.60E-21 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665 9.62E-07 3.96E-12 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251