Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013390665:

Variant ID: vg1013390665 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 13390665
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.59, T: 0.41, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

GCGGGAAATTCGGTTTTGTTTCGTTTTGGAAACATTCCGAAAAATCCGGTGCGTGAAAATGGCGTGAAGTCCGGATAAATTATGCGCGACTTATCCGGTT[T/C]
GGTTACGTGGAGTGGAGATCGTGCGGACGCCCTGATCAAGCGACCTATCTCTACATAAACCGAGCCGCCGCCTTCACGCAACACACGCGAAATCAATCAT

Reverse complement sequence

ATGATTGATTTCGCGTGTGTTGCGTGAAGGCGGCGGCTCGGTTTATGTAGAGATAGGTCGCTTGATCAGGGCGTCCGCACGATCTCCACTCCACGTAACC[A/G]
AACCGGATAAGTCGCGCATAATTTATCCGGACTTCACGCCATTTTCACGCACCGGATTTTTCGGAATGTTTCCAAAACGAAACAAAACCGAATTTCCCGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.20%	30.60%	1.29%	0.00%	NA
All Indica	2759	86.70%	11.10%	2.14%	0.00%	NA
All Japonica	1512	32.40%	67.60%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	90.80%	5.20%	4.03%	0.00%	NA
Indica II	465	94.40%	3.40%	2.15%	0.00%	NA
Indica III	913	84.00%	15.80%	0.22%	0.00%	NA
Indica Intermediate	786	82.30%	14.80%	2.93%	0.00%	NA
Temperate Japonica	767	5.90%	94.10%	0.00%	0.00%	NA
Tropical Japonica	504	65.90%	34.10%	0.00%	0.00%	NA
Japonica Intermediate	241	46.90%	53.10%	0.00%	0.00%	NA
VI/Aromatic	96	20.80%	79.20%	0.00%	0.00%	NA
Intermediate	90	55.60%	42.20%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1013390665	T -> C	LOC_Os10g25830.1	upstream_gene_variant ; 1862.0bp to feature; MODIFIER	silent_mutation	Average:58.719; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg1013390665	T -> C	LOC_Os10g25850.1	upstream_gene_variant ; 2240.0bp to feature; MODIFIER	silent_mutation	Average:58.719; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg1013390665	T -> C	LOC_Os10g25830-LOC_Os10g25850	intergenic_region ; MODIFIER	silent_mutation	Average:58.719; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1013390665	NA	3.19E-07	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665	4.97E-06	NA	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665	NA	5.24E-14	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665	NA	5.59E-16	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665	5.04E-06	1.82E-09	mr1424	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665	2.56E-07	2.60E-37	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665	1.13E-12	5.80E-22	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665	NA	2.52E-07	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665	6.30E-07	8.97E-33	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665	2.92E-11	2.61E-26	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665	NA	4.82E-18	mr1156_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665	NA	9.09E-08	mr1156_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665	NA	3.12E-15	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665	5.26E-09	2.85E-38	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665	3.27E-14	1.49E-29	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665	NA	7.22E-08	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665	8.39E-07	1.60E-21	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013390665	9.62E-07	3.96E-12	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251