\
| Variant ID: vg1013341735 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13341735 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, G: 0.22, others allele: 0.00, population size: 186. )
CCGGTGCATTCTTCTGACACCATTGCCAACTTAACCTACACACAGGATAAACGATCTTGTTAGCGAGTTAATCCGATTGTTATTACCAGATTAAGTTGTG[C/G]
GACAATACTTACAAGGAGTAGCACTTAAGGAGGCTTGTGTCCACCGCTCGGAGCCTGTAGAGGTCGAATAGATCCTTGAAGTCGACAACGATATAATTTG
CAAATTATATCGTTGTCGACTTCAAGGATCTATTCGACCTCTACAGGCTCCGAGCGGTGGACACAAGCCTCCTTAAGTGCTACTCCTTGTAAGTATTGTC[G/C]
CACAACTTAATCTGGTAATAACAATCGGATTAACTCGCTAACAAGATCGTTTATCCTGTGTGTAGGTTAAGTTGGCAATGGTGTCAGAAGAATGCACCGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.50% | 26.40% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 98.60% | 1.30% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 27.90% | 72.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.60% | 2.20% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 5.70% | 94.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 53.20% | 46.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 45.60% | 54.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 18.80% | 81.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 46.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013341735 | C -> G | LOC_Os10g25740.1 | upstream_gene_variant ; 1968.0bp to feature; MODIFIER | silent_mutation | Average:27.007; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg1013341735 | C -> G | LOC_Os10g25760.1 | downstream_gene_variant ; 3694.0bp to feature; MODIFIER | silent_mutation | Average:27.007; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg1013341735 | C -> G | LOC_Os10g25750.1 | intron_variant ; MODIFIER | silent_mutation | Average:27.007; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013341735 | NA | 5.65E-10 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013341735 | 1.98E-06 | NA | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013341735 | NA | 8.04E-11 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013341735 | NA | 1.37E-13 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013341735 | NA | 1.93E-07 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013341735 | NA | 1.48E-09 | mr1442 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013341735 | NA | 7.63E-07 | mr1450 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013341735 | NA | 2.39E-06 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013341735 | 5.87E-11 | 1.11E-46 | mr1533 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013341735 | 2.37E-10 | 6.82E-19 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013341735 | NA | 2.97E-06 | mr1681 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013341735 | NA | 3.86E-06 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013341735 | 3.71E-08 | 4.58E-42 | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013341735 | 2.32E-06 | 1.53E-19 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013341735 | NA | 4.94E-18 | mr1156_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013341735 | 1.00E-06 | 1.83E-41 | mr1533_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013341735 | 7.24E-09 | 8.15E-23 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013341735 | NA | 2.12E-08 | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013341735 | NA | 4.76E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013341735 | 4.02E-07 | 8.68E-23 | mr1980_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013341735 | NA | 4.08E-10 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |