Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1013341735:

Variant ID: vg1013341735 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 13341735
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, G: 0.22, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:

CCGGTGCATTCTTCTGACACCATTGCCAACTTAACCTACACACAGGATAAACGATCTTGTTAGCGAGTTAATCCGATTGTTATTACCAGATTAAGTTGTG[C/G]
GACAATACTTACAAGGAGTAGCACTTAAGGAGGCTTGTGTCCACCGCTCGGAGCCTGTAGAGGTCGAATAGATCCTTGAAGTCGACAACGATATAATTTG

Reverse complement sequence

CAAATTATATCGTTGTCGACTTCAAGGATCTATTCGACCTCTACAGGCTCCGAGCGGTGGACACAAGCCTCCTTAAGTGCTACTCCTTGTAAGTATTGTC[G/C]
CACAACTTAATCTGGTAATAACAATCGGATTAACTCGCTAACAAGATCGTTTATCCTGTGTGTAGGTTAAGTTGGCAATGGTGTCAGAAGAATGCACCGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.50%	26.40%	0.11%	0.00%	NA
All Indica	2759	98.60%	1.30%	0.11%	0.00%	NA
All Japonica	1512	27.90%	72.10%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.50%	0.30%	0.17%	0.00%	NA
Indica II	465	96.60%	3.40%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	97.60%	2.20%	0.25%	0.00%	NA
Temperate Japonica	767	5.70%	94.30%	0.00%	0.00%	NA
Tropical Japonica	504	53.20%	46.80%	0.00%	0.00%	NA
Japonica Intermediate	241	45.60%	54.40%	0.00%	0.00%	NA
VI/Aromatic	96	18.80%	81.20%	0.00%	0.00%	NA
Intermediate	90	51.10%	46.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1013341735	C -> G	LOC_Os10g25740.1	upstream_gene_variant ; 1968.0bp to feature; MODIFIER	silent_mutation	Average:27.007; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg1013341735	C -> G	LOC_Os10g25760.1	downstream_gene_variant ; 3694.0bp to feature; MODIFIER	silent_mutation	Average:27.007; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg1013341735	C -> G	LOC_Os10g25750.1	intron_variant ; MODIFIER	silent_mutation	Average:27.007; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1013341735	NA	5.65E-10	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013341735	1.98E-06	NA	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013341735	NA	8.04E-11	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013341735	NA	1.37E-13	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013341735	NA	1.93E-07	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013341735	NA	1.48E-09	mr1442	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013341735	NA	7.63E-07	mr1450	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013341735	NA	2.39E-06	mr1511	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013341735	5.87E-11	1.11E-46	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013341735	2.37E-10	6.82E-19	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013341735	NA	2.97E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013341735	NA	3.86E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013341735	3.71E-08	4.58E-42	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013341735	2.32E-06	1.53E-19	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013341735	NA	4.94E-18	mr1156_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013341735	1.00E-06	1.83E-41	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013341735	7.24E-09	8.15E-23	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013341735	NA	2.12E-08	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013341735	NA	4.76E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013341735	4.02E-07	8.68E-23	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013341735	NA	4.08E-10	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251