Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1013330987:

Variant ID: vg1013330987 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13330987
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


CACCTAGGCACGAGAGGGGACTGCTCGCTGCCTTGCGAGGAGTGGGGGTGAAACCTGAGGTGTAGTGTGCTTGGTTAGAGGGGGTTATGCGAAGGGTCCT[A/G]
TCACGGCCTCTATCCGGTATGTCGTGGTGGCATGTCGGCGCACGAAAACGTATCGTGGGGCTGTGTCTTGTGTGTACAGTTGTACACCTCTGATAAGAGT

Reverse complement sequence

ACTCTTATCAGAGGTGTACAACTGTACACACAAGACACAGCCCCACGATACGTTTTCGTGCGCCGACATGCCACCACGACATACCGGATAGAGGCCGTGA[T/C]
AGGACCCTTCGCATAACCCCCTCTAACCAAGCACACTACACCTCAGGTTTCACCCCCACTCCTCGCAAGGCAGCGAGCAGTCCCCTCTCGTGCCTAGGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.90% 28.10% 0.06% 0.00% NA
All Indica  2759 98.90% 1.00% 0.04% 0.00% NA
All Japonica  1512 21.20% 78.80% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.30% 0.17% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.50% 1.50% 0.00% 0.00% NA
Temperate Japonica  767 3.10% 96.90% 0.00% 0.00% NA
Tropical Japonica  504 46.80% 53.20% 0.00% 0.00% NA
Japonica Intermediate  241 25.30% 74.70% 0.00% 0.00% NA
VI/Aromatic  96 27.10% 72.90% 0.00% 0.00% NA
Intermediate  90 55.60% 42.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013330987 A -> G LOC_Os10g25730.1 upstream_gene_variant ; 2703.0bp to feature; MODIFIER silent_mutation Average:61.181; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 N N N N
vg1013330987 A -> G LOC_Os10g25730-LOC_Os10g25740 intergenic_region ; MODIFIER silent_mutation Average:61.181; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013330987 NA 7.33E-07 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013330987 3.66E-06 1.15E-12 mr1005 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013330987 NA 1.45E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013330987 NA 5.74E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013330987 NA 1.79E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013330987 1.08E-08 9.07E-46 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013330987 NA 4.51E-12 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013330987 NA 9.44E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013330987 NA 9.82E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013330987 3.86E-06 5.52E-39 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013330987 NA 4.53E-12 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013330987 NA 3.70E-22 mr1304_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013330987 4.83E-11 7.51E-47 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013330987 4.13E-08 1.87E-18 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013330987 NA 2.26E-08 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013330987 1.55E-07 1.18E-22 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013330987 NA 6.46E-09 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251