\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013280851:

Variant ID: vg1013280851 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13280851
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAAATCAAACTAATTCAAGTTTAAATAAGTTTATAGCCAAATATTGTAATATTTATAATACAAAATTAGTTTCATTAAATCAATAATTGAATATATTTT[C/T]
ATAATAAATTTGTCTTGGGTTGAAAATGTTATTATTTTTTTCTACAATATTAGTAAAACTTAAAGCATTTTGATTTTAATCAAAGTTAAAACGTCTTATG

Reverse complement sequence

CATAAGACGTTTTAACTTTGATTAAAATCAAAATGCTTTAAGTTTTACTAATATTGTAGAAAAAAATAATAACATTTTCAACCCAAGACAAATTTATTAT[G/A]
AAAATATATTCAATTATTGATTTAATGAAACTAATTTTGTATTATAAATATTACAATATTTGGCTATAAACTTATTTAAACTTGAATTAGTTTGATTTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.10% 16.80% 1.14% 0.00% NA
All Indica  2759 76.90% 23.10% 0.00% 0.00% NA
All Japonica  1512 87.00% 9.70% 3.37% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 71.60% 28.40% 0.00% 0.00% NA
Indica II  465 95.50% 4.50% 0.00% 0.00% NA
Indica III  913 72.10% 27.90% 0.00% 0.00% NA
Indica Intermediate  786 75.40% 24.60% 0.00% 0.00% NA
Temperate Japonica  767 81.40% 12.90% 5.74% 0.00% NA
Tropical Japonica  504 97.00% 3.00% 0.00% 0.00% NA
Japonica Intermediate  241 83.80% 13.30% 2.90% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 6.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013280851 C -> T LOC_Os10g25630.1 upstream_gene_variant ; 1871.0bp to feature; MODIFIER silent_mutation Average:33.409; most accessible tissue: Callus, score: 48.325 N N N N
vg1013280851 C -> T LOC_Os10g25640.1 upstream_gene_variant ; 130.0bp to feature; MODIFIER silent_mutation Average:33.409; most accessible tissue: Callus, score: 48.325 N N N N
vg1013280851 C -> T LOC_Os10g25660.1 downstream_gene_variant ; 3158.0bp to feature; MODIFIER silent_mutation Average:33.409; most accessible tissue: Callus, score: 48.325 N N N N
vg1013280851 C -> T LOC_Os10g25640-LOC_Os10g25660 intergenic_region ; MODIFIER silent_mutation Average:33.409; most accessible tissue: Callus, score: 48.325 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013280851 1.37E-11 NA mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013280851 6.11E-15 3.87E-20 mr1533 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013280851 2.25E-10 NA mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013280851 3.11E-15 1.97E-20 mr1980 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013280851 1.49E-06 1.49E-06 mr1197_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013280851 1.79E-16 NA mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013280851 1.79E-16 3.06E-26 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013280851 1.31E-11 NA mr1980_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013280851 2.37E-08 2.73E-12 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251