\
| Variant ID: vg1013280851 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 13280851 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAAAATCAAACTAATTCAAGTTTAAATAAGTTTATAGCCAAATATTGTAATATTTATAATACAAAATTAGTTTCATTAAATCAATAATTGAATATATTTT[C/T]
ATAATAAATTTGTCTTGGGTTGAAAATGTTATTATTTTTTTCTACAATATTAGTAAAACTTAAAGCATTTTGATTTTAATCAAAGTTAAAACGTCTTATG
CATAAGACGTTTTAACTTTGATTAAAATCAAAATGCTTTAAGTTTTACTAATATTGTAGAAAAAAATAATAACATTTTCAACCCAAGACAAATTTATTAT[G/A]
AAAATATATTCAATTATTGATTTAATGAAACTAATTTTGTATTATAAATATTACAATATTTGGCTATAAACTTATTTAAACTTGAATTAGTTTGATTTTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.10% | 16.80% | 1.14% | 0.00% | NA |
| All Indica | 2759 | 76.90% | 23.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 87.00% | 9.70% | 3.37% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 71.60% | 28.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 72.10% | 27.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 75.40% | 24.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 81.40% | 12.90% | 5.74% | 0.00% | NA |
| Tropical Japonica | 504 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 83.80% | 13.30% | 2.90% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 6.70% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1013280851 | C -> T | LOC_Os10g25630.1 | upstream_gene_variant ; 1871.0bp to feature; MODIFIER | silent_mutation | Average:33.409; most accessible tissue: Callus, score: 48.325 | N | N | N | N |
| vg1013280851 | C -> T | LOC_Os10g25640.1 | upstream_gene_variant ; 130.0bp to feature; MODIFIER | silent_mutation | Average:33.409; most accessible tissue: Callus, score: 48.325 | N | N | N | N |
| vg1013280851 | C -> T | LOC_Os10g25660.1 | downstream_gene_variant ; 3158.0bp to feature; MODIFIER | silent_mutation | Average:33.409; most accessible tissue: Callus, score: 48.325 | N | N | N | N |
| vg1013280851 | C -> T | LOC_Os10g25640-LOC_Os10g25660 | intergenic_region ; MODIFIER | silent_mutation | Average:33.409; most accessible tissue: Callus, score: 48.325 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1013280851 | 1.37E-11 | NA | mr1533 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013280851 | 6.11E-15 | 3.87E-20 | mr1533 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013280851 | 2.25E-10 | NA | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013280851 | 3.11E-15 | 1.97E-20 | mr1980 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013280851 | 1.49E-06 | 1.49E-06 | mr1197_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013280851 | 1.79E-16 | NA | mr1533_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013280851 | 1.79E-16 | 3.06E-26 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013280851 | 1.31E-11 | NA | mr1980_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1013280851 | 2.37E-08 | 2.73E-12 | mr1980_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |