Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1013280851:

Variant ID: vg1013280851 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 13280851
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAAAATCAAACTAATTCAAGTTTAAATAAGTTTATAGCCAAATATTGTAATATTTATAATACAAAATTAGTTTCATTAAATCAATAATTGAATATATTTT[C/T]
ATAATAAATTTGTCTTGGGTTGAAAATGTTATTATTTTTTTCTACAATATTAGTAAAACTTAAAGCATTTTGATTTTAATCAAAGTTAAAACGTCTTATG

Reverse complement sequence

CATAAGACGTTTTAACTTTGATTAAAATCAAAATGCTTTAAGTTTTACTAATATTGTAGAAAAAAATAATAACATTTTCAACCCAAGACAAATTTATTAT[G/A]
AAAATATATTCAATTATTGATTTAATGAAACTAATTTTGTATTATAAATATTACAATATTTGGCTATAAACTTATTTAAACTTGAATTAGTTTGATTTTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.10%	16.80%	1.14%	0.00%	NA
All Indica	2759	76.90%	23.10%	0.00%	0.00%	NA
All Japonica	1512	87.00%	9.70%	3.37%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	71.60%	28.40%	0.00%	0.00%	NA
Indica II	465	95.50%	4.50%	0.00%	0.00%	NA
Indica III	913	72.10%	27.90%	0.00%	0.00%	NA
Indica Intermediate	786	75.40%	24.60%	0.00%	0.00%	NA
Temperate Japonica	767	81.40%	12.90%	5.74%	0.00%	NA
Tropical Japonica	504	97.00%	3.00%	0.00%	0.00%	NA
Japonica Intermediate	241	83.80%	13.30%	2.90%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	6.70%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1013280851	C -> T	LOC_Os10g25630.1	upstream_gene_variant ; 1871.0bp to feature; MODIFIER	silent_mutation	Average:33.409; most accessible tissue: Callus, score: 48.325	N	N	N	N
vg1013280851	C -> T	LOC_Os10g25640.1	upstream_gene_variant ; 130.0bp to feature; MODIFIER	silent_mutation	Average:33.409; most accessible tissue: Callus, score: 48.325	N	N	N	N
vg1013280851	C -> T	LOC_Os10g25660.1	downstream_gene_variant ; 3158.0bp to feature; MODIFIER	silent_mutation	Average:33.409; most accessible tissue: Callus, score: 48.325	N	N	N	N
vg1013280851	C -> T	LOC_Os10g25640-LOC_Os10g25660	intergenic_region ; MODIFIER	silent_mutation	Average:33.409; most accessible tissue: Callus, score: 48.325	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1013280851	1.37E-11	NA	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013280851	6.11E-15	3.87E-20	mr1533	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013280851	2.25E-10	NA	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013280851	3.11E-15	1.97E-20	mr1980	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013280851	1.49E-06	1.49E-06	mr1197_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013280851	1.79E-16	NA	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013280851	1.79E-16	3.06E-26	mr1533_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013280851	1.31E-11	NA	mr1980_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013280851	2.37E-08	2.73E-12	mr1980_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251