\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012381817:

Variant ID: vg1012381817 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 12381817
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.56, T: 0.44, others allele: 0.00, population size: 43. )

Flanking Sequence (100 bp) in Reference Genome:


GCAAACACAACTCATAACAATTTCCCCCGCTTAAGAAGAGGCTTGTCCCCAAGCCGGAGAAGATGGGAAACGAAATTGCAGCTGTCGTAGATTCTCCCAT[T/G]
TAGCAAGAGCGGCAGGCAAACCAGTCCAACGGACTAATCCATTGGGCACAGCTGATTTACCTCGCTTGATGAGTTGGCGGTGCAAAATTTCTTCAGGAAT

Reverse complement sequence

ATTCCTGAAGAAATTTTGCACCGCCAACTCATCAAGCGAGGTAAATCAGCTGTGCCCAATGGATTAGTCCGTTGGACTGGTTTGCCTGCCGCTCTTGCTA[A/C]
ATGGGAGAATCTACGACAGCTGCAATTTCGTTTCCCATCTTCTCCGGCTTGGGGACAAGCCTCTTCTTAAGCGGGGGAAATTGTTATGAGTTGTGTTTGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.40% 29.60% 0.08% 1.90% NA
All Indica  2759 98.90% 0.70% 0.07% 0.33% NA
All Japonica  1512 11.10% 88.60% 0.00% 0.33% NA
Aus  269 97.80% 0.70% 0.00% 1.49% NA
Indica I  595 99.30% 0.30% 0.00% 0.34% NA
Indica II  465 98.50% 1.30% 0.00% 0.22% NA
Indica III  913 99.30% 0.20% 0.11% 0.33% NA
Indica Intermediate  786 98.20% 1.30% 0.13% 0.38% NA
Temperate Japonica  767 2.90% 96.90% 0.00% 0.26% NA
Tropical Japonica  504 20.00% 80.00% 0.00% 0.00% NA
Japonica Intermediate  241 18.70% 80.10% 0.00% 1.24% NA
VI/Aromatic  96 30.20% 4.20% 1.04% 64.58% NA
Intermediate  90 50.00% 37.80% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1012381817 T -> G LOC_Os10g24170.1 missense_variant ; p.Lys412Thr; MODERATE nonsynonymous_codon ; K412T Average:54.969; most accessible tissue: Minghui63 flag leaf, score: 80.516 possibly damaging -1.947 TOLERATED 1.00
vg1012381817 T -> DEL LOC_Os10g24170.1 N frameshift_variant Average:54.969; most accessible tissue: Minghui63 flag leaf, score: 80.516 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1012381817 NA 1.45E-25 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 8.37E-27 mr1223 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 7.50E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 8.70E-18 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 2.26E-52 mr1889 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 9.59E-25 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 4.40E-33 mr1081_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 3.88E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 1.22E-30 mr1102_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 9.04E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 9.30E-19 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 1.70E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 1.16E-35 mr1223_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 8.10E-33 mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 2.21E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 2.29E-20 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 6.00E-22 mr1304_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 6.20E-15 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 1.20E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 3.91E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 1.29E-19 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 1.36E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 3.54E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 8.38E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 2.16E-15 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 7.66E-36 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 6.73E-06 1.66E-69 mr1889_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 1.21E-66 mr1896_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 8.55E-13 mr1904_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 2.06E-94 mr1907_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 4.08E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 1.25E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 5.00E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 7.59E-81 mr1934_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012381817 NA 1.73E-40 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251