\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012377106:

Variant ID: vg1012377106 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 12377106
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


GTAGCTCTAGGATCGTGTTTACAAAATAGCTTTGAGCAACTAAGTGTCTTTTAAATGCTCTTTACTGCAAAACCTAACCCTATTATTATTACTCCTTGTA[C/T]
CCCCTTGCATTAAGCATGCATCTCCCGGTGTGACTTGCTGAGTACTGTGGTTGTACTCATTCTTGCTCTATCTTTCCCCCCTTCAGTAAGAGAAGCTTTG

Reverse complement sequence

CAAAGCTTCTCTTACTGAAGGGGGGAAAGATAGAGCAAGAATGAGTACAACCACAGTACTCAGCAAGTCACACCGGGAGATGCATGCTTAATGCAAGGGG[G/A]
TACAAGGAGTAATAATAATAGGGTTAGGTTTTGCAGTAAAGAGCATTTAAAAGACACTTAGTTGCTCAAAGCTATTTTGTAAACACGATCCTAGAGCTAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.90% 44.20% 0.91% 6.96% NA
All Indica  2759 29.20% 68.90% 0.22% 1.74% NA
All Japonica  1512 89.20% 10.30% 0.26% 0.26% NA
Aus  269 16.70% 0.70% 6.69% 75.84% NA
Indica I  595 7.20% 92.30% 0.00% 0.50% NA
Indica II  465 36.10% 62.20% 0.22% 1.51% NA
Indica III  913 34.70% 63.00% 0.33% 1.97% NA
Indica Intermediate  786 35.20% 62.00% 0.25% 2.54% NA
Temperate Japonica  767 97.30% 2.50% 0.13% 0.13% NA
Tropical Japonica  504 81.00% 19.00% 0.00% 0.00% NA
Japonica Intermediate  241 80.90% 16.60% 1.24% 1.24% NA
VI/Aromatic  96 17.70% 5.20% 10.42% 66.67% NA
Intermediate  90 55.60% 28.90% 5.56% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1012377106 C -> T LOC_Os10g24150.1 upstream_gene_variant ; 3223.0bp to feature; MODIFIER silent_mutation Average:50.881; most accessible tissue: Minghui63 flag leaf, score: 82.975 N N N N
vg1012377106 C -> T LOC_Os10g24160.1 upstream_gene_variant ; 1032.0bp to feature; MODIFIER silent_mutation Average:50.881; most accessible tissue: Minghui63 flag leaf, score: 82.975 N N N N
vg1012377106 C -> T LOC_Os10g24170.1 downstream_gene_variant ; 4641.0bp to feature; MODIFIER silent_mutation Average:50.881; most accessible tissue: Minghui63 flag leaf, score: 82.975 N N N N
vg1012377106 C -> T LOC_Os10g24150-LOC_Os10g24160 intergenic_region ; MODIFIER silent_mutation Average:50.881; most accessible tissue: Minghui63 flag leaf, score: 82.975 N N N N
vg1012377106 C -> DEL N N silent_mutation Average:50.881; most accessible tissue: Minghui63 flag leaf, score: 82.975 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1012377106 NA 1.09E-07 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012377106 NA 5.58E-12 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012377106 NA 2.03E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012377106 NA 3.72E-06 mr1689 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012377106 NA 1.48E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012377106 NA 8.14E-06 mr1771 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012377106 NA 3.01E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012377106 NA 4.40E-08 mr1446_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012377106 3.97E-06 6.97E-07 mr1467_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012377106 NA 6.78E-06 mr1811_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012377106 4.50E-06 4.49E-06 mr1816_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012377106 NA 3.38E-06 mr1823_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012377106 NA 5.20E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012377106 NA 6.85E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251