\
| Variant ID: vg1012377106 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 12377106 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 259. )
GTAGCTCTAGGATCGTGTTTACAAAATAGCTTTGAGCAACTAAGTGTCTTTTAAATGCTCTTTACTGCAAAACCTAACCCTATTATTATTACTCCTTGTA[C/T]
CCCCTTGCATTAAGCATGCATCTCCCGGTGTGACTTGCTGAGTACTGTGGTTGTACTCATTCTTGCTCTATCTTTCCCCCCTTCAGTAAGAGAAGCTTTG
CAAAGCTTCTCTTACTGAAGGGGGGAAAGATAGAGCAAGAATGAGTACAACCACAGTACTCAGCAAGTCACACCGGGAGATGCATGCTTAATGCAAGGGG[G/A]
TACAAGGAGTAATAATAATAGGGTTAGGTTTTGCAGTAAAGAGCATTTAAAAGACACTTAGTTGCTCAAAGCTATTTTGTAAACACGATCCTAGAGCTAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.90% | 44.20% | 0.91% | 6.96% | NA |
| All Indica | 2759 | 29.20% | 68.90% | 0.22% | 1.74% | NA |
| All Japonica | 1512 | 89.20% | 10.30% | 0.26% | 0.26% | NA |
| Aus | 269 | 16.70% | 0.70% | 6.69% | 75.84% | NA |
| Indica I | 595 | 7.20% | 92.30% | 0.00% | 0.50% | NA |
| Indica II | 465 | 36.10% | 62.20% | 0.22% | 1.51% | NA |
| Indica III | 913 | 34.70% | 63.00% | 0.33% | 1.97% | NA |
| Indica Intermediate | 786 | 35.20% | 62.00% | 0.25% | 2.54% | NA |
| Temperate Japonica | 767 | 97.30% | 2.50% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 81.00% | 19.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.90% | 16.60% | 1.24% | 1.24% | NA |
| VI/Aromatic | 96 | 17.70% | 5.20% | 10.42% | 66.67% | NA |
| Intermediate | 90 | 55.60% | 28.90% | 5.56% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1012377106 | C -> T | LOC_Os10g24150.1 | upstream_gene_variant ; 3223.0bp to feature; MODIFIER | silent_mutation | Average:50.881; most accessible tissue: Minghui63 flag leaf, score: 82.975 | N | N | N | N |
| vg1012377106 | C -> T | LOC_Os10g24160.1 | upstream_gene_variant ; 1032.0bp to feature; MODIFIER | silent_mutation | Average:50.881; most accessible tissue: Minghui63 flag leaf, score: 82.975 | N | N | N | N |
| vg1012377106 | C -> T | LOC_Os10g24170.1 | downstream_gene_variant ; 4641.0bp to feature; MODIFIER | silent_mutation | Average:50.881; most accessible tissue: Minghui63 flag leaf, score: 82.975 | N | N | N | N |
| vg1012377106 | C -> T | LOC_Os10g24150-LOC_Os10g24160 | intergenic_region ; MODIFIER | silent_mutation | Average:50.881; most accessible tissue: Minghui63 flag leaf, score: 82.975 | N | N | N | N |
| vg1012377106 | C -> DEL | N | N | silent_mutation | Average:50.881; most accessible tissue: Minghui63 flag leaf, score: 82.975 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1012377106 | NA | 1.09E-07 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012377106 | NA | 5.58E-12 | mr1329 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012377106 | NA | 2.03E-09 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012377106 | NA | 3.72E-06 | mr1689 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012377106 | NA | 1.48E-07 | mr1716 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012377106 | NA | 8.14E-06 | mr1771 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012377106 | NA | 3.01E-06 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012377106 | NA | 4.40E-08 | mr1446_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012377106 | 3.97E-06 | 6.97E-07 | mr1467_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012377106 | NA | 6.78E-06 | mr1811_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012377106 | 4.50E-06 | 4.49E-06 | mr1816_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012377106 | NA | 3.38E-06 | mr1823_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012377106 | NA | 5.20E-07 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012377106 | NA | 6.85E-06 | mr1856_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |