Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1012377106:

Variant ID: vg1012377106 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 12377106
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

GTAGCTCTAGGATCGTGTTTACAAAATAGCTTTGAGCAACTAAGTGTCTTTTAAATGCTCTTTACTGCAAAACCTAACCCTATTATTATTACTCCTTGTA[C/T]
CCCCTTGCATTAAGCATGCATCTCCCGGTGTGACTTGCTGAGTACTGTGGTTGTACTCATTCTTGCTCTATCTTTCCCCCCTTCAGTAAGAGAAGCTTTG

Reverse complement sequence

CAAAGCTTCTCTTACTGAAGGGGGGAAAGATAGAGCAAGAATGAGTACAACCACAGTACTCAGCAAGTCACACCGGGAGATGCATGCTTAATGCAAGGGG[G/A]
TACAAGGAGTAATAATAATAGGGTTAGGTTTTGCAGTAAAGAGCATTTAAAAGACACTTAGTTGCTCAAAGCTATTTTGTAAACACGATCCTAGAGCTAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.90%	44.20%	0.91%	6.96%	NA
All Indica	2759	29.20%	68.90%	0.22%	1.74%	NA
All Japonica	1512	89.20%	10.30%	0.26%	0.26%	NA
Aus	269	16.70%	0.70%	6.69%	75.84%	NA
Indica I	595	7.20%	92.30%	0.00%	0.50%	NA
Indica II	465	36.10%	62.20%	0.22%	1.51%	NA
Indica III	913	34.70%	63.00%	0.33%	1.97%	NA
Indica Intermediate	786	35.20%	62.00%	0.25%	2.54%	NA
Temperate Japonica	767	97.30%	2.50%	0.13%	0.13%	NA
Tropical Japonica	504	81.00%	19.00%	0.00%	0.00%	NA
Japonica Intermediate	241	80.90%	16.60%	1.24%	1.24%	NA
VI/Aromatic	96	17.70%	5.20%	10.42%	66.67%	NA
Intermediate	90	55.60%	28.90%	5.56%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1012377106	C -> T	LOC_Os10g24150.1	upstream_gene_variant ; 3223.0bp to feature; MODIFIER	silent_mutation	Average:50.881; most accessible tissue: Minghui63 flag leaf, score: 82.975	N	N	N	N
vg1012377106	C -> T	LOC_Os10g24160.1	upstream_gene_variant ; 1032.0bp to feature; MODIFIER	silent_mutation	Average:50.881; most accessible tissue: Minghui63 flag leaf, score: 82.975	N	N	N	N
vg1012377106	C -> T	LOC_Os10g24170.1	downstream_gene_variant ; 4641.0bp to feature; MODIFIER	silent_mutation	Average:50.881; most accessible tissue: Minghui63 flag leaf, score: 82.975	N	N	N	N
vg1012377106	C -> T	LOC_Os10g24150-LOC_Os10g24160	intergenic_region ; MODIFIER	silent_mutation	Average:50.881; most accessible tissue: Minghui63 flag leaf, score: 82.975	N	N	N	N
vg1012377106	C -> DEL	N	N	silent_mutation	Average:50.881; most accessible tissue: Minghui63 flag leaf, score: 82.975	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1012377106	NA	1.09E-07	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012377106	NA	5.58E-12	mr1329	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012377106	NA	2.03E-09	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012377106	NA	3.72E-06	mr1689	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012377106	NA	1.48E-07	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012377106	NA	8.14E-06	mr1771	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012377106	NA	3.01E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012377106	NA	4.40E-08	mr1446_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012377106	3.97E-06	6.97E-07	mr1467_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012377106	NA	6.78E-06	mr1811_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012377106	4.50E-06	4.49E-06	mr1816_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012377106	NA	3.38E-06	mr1823_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012377106	NA	5.20E-07	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012377106	NA	6.85E-06	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251