Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1012313676:

Variant ID: vg1012313676 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 12313676
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

ACAGATACACATTTGAAATATTAAACATAGTCTAATAACAAAACAAATTACAGATTCCGCCAGAAAACCGCGAGACGAATTTATTGAGCCTAATTAGTTC[G/A]
TCATTAGCAAATGTTTATTGTAGTACCACATTGTCAAATCCGTCGAATCCGAATTTATTAAGCCTAATTAATCCATCATTAGCAAATGCTTACTGCACAA

Reverse complement sequence

TTGTGCAGTAAGCATTTGCTAATGATGGATTAATTAGGCTTAATAAATTCGGATTCGACGGATTTGACAATGTGGTACTACAATAAACATTTGCTAATGA[C/T]
GAACTAATTAGGCTCAATAAATTCGTCTCGCGGTTTTCTGGCGGAATCTGTAATTTGTTTTGTTATTAGACTATGTTTAATATTTCAAATGTGTATCTGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.30%	19.70%	0.97%	0.00%	NA
All Indica	2759	72.10%	27.10%	0.76%	0.00%	NA
All Japonica	1512	89.40%	9.20%	1.39%	0.00%	NA
Aus	269	91.10%	8.90%	0.00%	0.00%	NA
Indica I	595	93.10%	6.70%	0.17%	0.00%	NA
Indica II	465	65.20%	34.20%	0.65%	0.00%	NA
Indica III	913	67.00%	31.90%	1.10%	0.00%	NA
Indica Intermediate	786	66.30%	32.80%	0.89%	0.00%	NA
Temperate Japonica	767	94.80%	3.90%	1.30%	0.00%	NA
Tropical Japonica	504	86.90%	12.30%	0.79%	0.00%	NA
Japonica Intermediate	241	77.60%	19.50%	2.90%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	75.60%	20.00%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1012313676	G -> A	LOC_Os10g24020.1	upstream_gene_variant ; 2067.0bp to feature; MODIFIER	silent_mutation	Average:41.238; most accessible tissue: Callus, score: 59.424	N	N	N	N
vg1012313676	G -> A	LOC_Os10g24040.1	upstream_gene_variant ; 3172.0bp to feature; MODIFIER	silent_mutation	Average:41.238; most accessible tissue: Callus, score: 59.424	N	N	N	N
vg1012313676	G -> A	LOC_Os10g24020.2	upstream_gene_variant ; 2067.0bp to feature; MODIFIER	silent_mutation	Average:41.238; most accessible tissue: Callus, score: 59.424	N	N	N	N
vg1012313676	G -> A	LOC_Os10g24030.1	downstream_gene_variant ; 876.0bp to feature; MODIFIER	silent_mutation	Average:41.238; most accessible tissue: Callus, score: 59.424	N	N	N	N
vg1012313676	G -> A	LOC_Os10g24030-LOC_Os10g24040	intergenic_region ; MODIFIER	silent_mutation	Average:41.238; most accessible tissue: Callus, score: 59.424	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1012313676	NA	3.32E-06	Grain_weight	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1012313676	NA	2.11E-09	mr1157	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012313676	NA	1.95E-06	mr1157	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012313676	7.63E-06	3.65E-11	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012313676	6.38E-06	2.37E-08	mr1328	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012313676	4.26E-06	1.64E-11	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012313676	3.87E-06	3.31E-08	mr1446	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012313676	1.04E-07	8.55E-14	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012313676	4.31E-06	1.73E-09	mr1446_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012313676	NA	6.77E-06	mr1567_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251