\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012313676:

Variant ID: vg1012313676 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 12313676
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


ACAGATACACATTTGAAATATTAAACATAGTCTAATAACAAAACAAATTACAGATTCCGCCAGAAAACCGCGAGACGAATTTATTGAGCCTAATTAGTTC[G/A]
TCATTAGCAAATGTTTATTGTAGTACCACATTGTCAAATCCGTCGAATCCGAATTTATTAAGCCTAATTAATCCATCATTAGCAAATGCTTACTGCACAA

Reverse complement sequence

TTGTGCAGTAAGCATTTGCTAATGATGGATTAATTAGGCTTAATAAATTCGGATTCGACGGATTTGACAATGTGGTACTACAATAAACATTTGCTAATGA[C/T]
GAACTAATTAGGCTCAATAAATTCGTCTCGCGGTTTTCTGGCGGAATCTGTAATTTGTTTTGTTATTAGACTATGTTTAATATTTCAAATGTGTATCTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.30% 19.70% 0.97% 0.00% NA
All Indica  2759 72.10% 27.10% 0.76% 0.00% NA
All Japonica  1512 89.40% 9.20% 1.39% 0.00% NA
Aus  269 91.10% 8.90% 0.00% 0.00% NA
Indica I  595 93.10% 6.70% 0.17% 0.00% NA
Indica II  465 65.20% 34.20% 0.65% 0.00% NA
Indica III  913 67.00% 31.90% 1.10% 0.00% NA
Indica Intermediate  786 66.30% 32.80% 0.89% 0.00% NA
Temperate Japonica  767 94.80% 3.90% 1.30% 0.00% NA
Tropical Japonica  504 86.90% 12.30% 0.79% 0.00% NA
Japonica Intermediate  241 77.60% 19.50% 2.90% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 75.60% 20.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1012313676 G -> A LOC_Os10g24020.1 upstream_gene_variant ; 2067.0bp to feature; MODIFIER silent_mutation Average:41.238; most accessible tissue: Callus, score: 59.424 N N N N
vg1012313676 G -> A LOC_Os10g24040.1 upstream_gene_variant ; 3172.0bp to feature; MODIFIER silent_mutation Average:41.238; most accessible tissue: Callus, score: 59.424 N N N N
vg1012313676 G -> A LOC_Os10g24020.2 upstream_gene_variant ; 2067.0bp to feature; MODIFIER silent_mutation Average:41.238; most accessible tissue: Callus, score: 59.424 N N N N
vg1012313676 G -> A LOC_Os10g24030.1 downstream_gene_variant ; 876.0bp to feature; MODIFIER silent_mutation Average:41.238; most accessible tissue: Callus, score: 59.424 N N N N
vg1012313676 G -> A LOC_Os10g24030-LOC_Os10g24040 intergenic_region ; MODIFIER silent_mutation Average:41.238; most accessible tissue: Callus, score: 59.424 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1012313676 NA 3.32E-06 Grain_weight Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1012313676 NA 2.11E-09 mr1157 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012313676 NA 1.95E-06 mr1157 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012313676 7.63E-06 3.65E-11 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012313676 6.38E-06 2.37E-08 mr1328 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012313676 4.26E-06 1.64E-11 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012313676 3.87E-06 3.31E-08 mr1446 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012313676 1.04E-07 8.55E-14 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012313676 4.31E-06 1.73E-09 mr1446_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012313676 NA 6.77E-06 mr1567_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251