\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012297597:

Variant ID: vg1012297597 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 12297597
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, G: 0.02, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


AGAATCTCATGCGGCGGGGCGCCGGCCACGACGACGCCGTGCCGTGGTTGCATTACCCTGCCGTGGACGACGCCAACGCTGACACGGCGCCGCTGCCTCC[C/G]
GAGTACTGCGCCGCTGCCTCCCAACAACTGCGCCGCCTTGCTCAGCTCCGGCTTCTCCGACCACCTCCCGCCGCCCGCCGCGGAGACCAGAGACCCCTGC

Reverse complement sequence

GCAGGGGTCTCTGGTCTCCGCGGCGGGCGGCGGGAGGTGGTCGGAGAAGCCGGAGCTGAGCAAGGCGGCGCAGTTGTTGGGAGGCAGCGGCGCAGTACTC[G/C]
GGAGGCAGCGGCGCCGTGTCAGCGTTGGCGTCGTCCACGGCAGGGTAATGCAACCACGGCACGGCGTCGTCGTGGCCGGCGCCCCGCCGCATGAGATTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.40% 17.60% 0.34% 42.68% NA
All Indica  2759 4.00% 28.50% 0.51% 66.98% NA
All Japonica  1512 90.10% 0.30% 0.13% 9.46% NA
Aus  269 90.70% 8.90% 0.00% 0.37% NA
Indica I  595 2.50% 7.10% 1.18% 89.24% NA
Indica II  465 3.70% 36.60% 0.86% 58.92% NA
Indica III  913 4.10% 33.50% 0.33% 62.10% NA
Indica Intermediate  786 5.30% 34.10% 0.00% 60.56% NA
Temperate Japonica  767 97.50% 0.30% 0.00% 2.22% NA
Tropical Japonica  504 82.10% 0.20% 0.40% 17.26% NA
Japonica Intermediate  241 83.00% 0.80% 0.00% 16.18% NA
VI/Aromatic  96 95.80% 1.00% 0.00% 3.12% NA
Intermediate  90 57.80% 17.80% 0.00% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1012297597 C -> G LOC_Os10g24000.1 missense_variant ; p.Arg82Pro; MODERATE nonsynonymous_codon ; R82P Average:36.134; most accessible tissue: Zhenshan97 panicle, score: 57.341 unknown unknown TOLERATED 0.25
vg1012297597 C -> DEL LOC_Os10g24000.1 N frameshift_variant Average:36.134; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1012297597 NA 1.05E-08 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012297597 1.84E-06 2.29E-07 mr1157 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012297597 4.52E-07 5.31E-11 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012297597 1.83E-07 1.15E-09 mr1328 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012297597 3.33E-06 4.57E-11 mr1446 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012297597 6.81E-07 5.90E-09 mr1446 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012297597 1.61E-06 9.58E-13 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012297597 NA 1.44E-08 mr1446_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251