| Variant ID: vg1012297597 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 12297597 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, G: 0.02, others allele: 0.00, population size: 86. )
AGAATCTCATGCGGCGGGGCGCCGGCCACGACGACGCCGTGCCGTGGTTGCATTACCCTGCCGTGGACGACGCCAACGCTGACACGGCGCCGCTGCCTCC[C/G]
GAGTACTGCGCCGCTGCCTCCCAACAACTGCGCCGCCTTGCTCAGCTCCGGCTTCTCCGACCACCTCCCGCCGCCCGCCGCGGAGACCAGAGACCCCTGC
GCAGGGGTCTCTGGTCTCCGCGGCGGGCGGCGGGAGGTGGTCGGAGAAGCCGGAGCTGAGCAAGGCGGCGCAGTTGTTGGGAGGCAGCGGCGCAGTACTC[G/C]
GGAGGCAGCGGCGCCGTGTCAGCGTTGGCGTCGTCCACGGCAGGGTAATGCAACCACGGCACGGCGTCGTCGTGGCCGGCGCCCCGCCGCATGAGATTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.40% | 17.60% | 0.34% | 42.68% | NA |
| All Indica | 2759 | 4.00% | 28.50% | 0.51% | 66.98% | NA |
| All Japonica | 1512 | 90.10% | 0.30% | 0.13% | 9.46% | NA |
| Aus | 269 | 90.70% | 8.90% | 0.00% | 0.37% | NA |
| Indica I | 595 | 2.50% | 7.10% | 1.18% | 89.24% | NA |
| Indica II | 465 | 3.70% | 36.60% | 0.86% | 58.92% | NA |
| Indica III | 913 | 4.10% | 33.50% | 0.33% | 62.10% | NA |
| Indica Intermediate | 786 | 5.30% | 34.10% | 0.00% | 60.56% | NA |
| Temperate Japonica | 767 | 97.50% | 0.30% | 0.00% | 2.22% | NA |
| Tropical Japonica | 504 | 82.10% | 0.20% | 0.40% | 17.26% | NA |
| Japonica Intermediate | 241 | 83.00% | 0.80% | 0.00% | 16.18% | NA |
| VI/Aromatic | 96 | 95.80% | 1.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 57.80% | 17.80% | 0.00% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1012297597 | C -> G | LOC_Os10g24000.1 | missense_variant ; p.Arg82Pro; MODERATE | nonsynonymous_codon ; R82P | Average:36.134; most accessible tissue: Zhenshan97 panicle, score: 57.341 | unknown | unknown | TOLERATED | 0.25 |
| vg1012297597 | C -> DEL | LOC_Os10g24000.1 | N | frameshift_variant | Average:36.134; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1012297597 | NA | 1.05E-08 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012297597 | 1.84E-06 | 2.29E-07 | mr1157 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012297597 | 4.52E-07 | 5.31E-11 | mr1328 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012297597 | 1.83E-07 | 1.15E-09 | mr1328 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012297597 | 3.33E-06 | 4.57E-11 | mr1446 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012297597 | 6.81E-07 | 5.90E-09 | mr1446 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012297597 | 1.61E-06 | 9.58E-13 | mr1446_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1012297597 | NA | 1.44E-08 | mr1446_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |