Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1012242711:

Variant ID: vg1012242711 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 12242711
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAAGTTATCTGGACGTTGCATCGGCTTACAAGGATTACATAAATATATAAGTTGGATTTAGCCAATGGCAACAAAGGTTTCACTGTTTAATCTAATCTAT[G/C]
GATTTTATGGCATCGGACCTTCAGCCGATGTATGCTTTAACCTTCGGATCAGTGCTTATTCTCTCTTATCATTGCTAGCCGATTGGTTTATATTGGATTA

Reverse complement sequence

TAATCCAATATAAACCAATCGGCTAGCAATGATAAGAGAGAATAAGCACTGATCCGAAGGTTAAAGCATACATCGGCTGAAGGTCCGATGCCATAAAATC[C/G]
ATAGATTAGATTAAACAGTGAAACCTTTGTTGCCATTGGCTAAATCCAACTTATATATTTATGTAATCCTTGTAAGCCGATGCAACGTCCAGATAACTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.60%	0.20%	3.05%	43.19%	NA
All Indica	2759	36.70%	0.30%	3.99%	59.01%	NA
All Japonica	1512	91.20%	0.00%	0.79%	8.00%	NA
Aus	269	23.00%	0.00%	5.95%	71.00%	NA
Indica I	595	17.50%	0.50%	5.71%	76.30%	NA
Indica II	465	44.30%	0.90%	3.23%	51.61%	NA
Indica III	913	40.00%	0.20%	4.05%	55.75%	NA
Indica Intermediate	786	42.90%	0.00%	3.05%	54.07%	NA
Temperate Japonica	767	97.70%	0.00%	0.00%	2.35%	NA
Tropical Japonica	504	84.70%	0.00%	0.79%	14.48%	NA
Japonica Intermediate	241	84.20%	0.00%	3.32%	12.45%	NA
VI/Aromatic	96	19.80%	0.00%	5.21%	75.00%	NA
Intermediate	90	66.70%	0.00%	1.11%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1012242711	G -> C	LOC_Os10g23860.1	upstream_gene_variant ; 4287.0bp to feature; MODIFIER	silent_mutation	Average:9.407; most accessible tissue: Callus, score: 18.787	N	N	N	N
vg1012242711	G -> C	LOC_Os10g23870.1	upstream_gene_variant ; 1289.0bp to feature; MODIFIER	silent_mutation	Average:9.407; most accessible tissue: Callus, score: 18.787	N	N	N	N
vg1012242711	G -> C	LOC_Os10g23880.1	downstream_gene_variant ; 2842.0bp to feature; MODIFIER	silent_mutation	Average:9.407; most accessible tissue: Callus, score: 18.787	N	N	N	N
vg1012242711	G -> C	LOC_Os10g23870-LOC_Os10g23880	intergenic_region ; MODIFIER	silent_mutation	Average:9.407; most accessible tissue: Callus, score: 18.787	N	N	N	N
vg1012242711	G -> DEL	N	N	silent_mutation	Average:9.407; most accessible tissue: Callus, score: 18.787	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1012242711	4.56E-06	NA	mr1501	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012242711	3.72E-06	3.72E-06	mr1501	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251