\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012242711:

Variant ID: vg1012242711 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 12242711
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAGTTATCTGGACGTTGCATCGGCTTACAAGGATTACATAAATATATAAGTTGGATTTAGCCAATGGCAACAAAGGTTTCACTGTTTAATCTAATCTAT[G/C]
GATTTTATGGCATCGGACCTTCAGCCGATGTATGCTTTAACCTTCGGATCAGTGCTTATTCTCTCTTATCATTGCTAGCCGATTGGTTTATATTGGATTA

Reverse complement sequence

TAATCCAATATAAACCAATCGGCTAGCAATGATAAGAGAGAATAAGCACTGATCCGAAGGTTAAAGCATACATCGGCTGAAGGTCCGATGCCATAAAATC[C/G]
ATAGATTAGATTAAACAGTGAAACCTTTGTTGCCATTGGCTAAATCCAACTTATATATTTATGTAATCCTTGTAAGCCGATGCAACGTCCAGATAACTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.60% 0.20% 3.05% 43.19% NA
All Indica  2759 36.70% 0.30% 3.99% 59.01% NA
All Japonica  1512 91.20% 0.00% 0.79% 8.00% NA
Aus  269 23.00% 0.00% 5.95% 71.00% NA
Indica I  595 17.50% 0.50% 5.71% 76.30% NA
Indica II  465 44.30% 0.90% 3.23% 51.61% NA
Indica III  913 40.00% 0.20% 4.05% 55.75% NA
Indica Intermediate  786 42.90% 0.00% 3.05% 54.07% NA
Temperate Japonica  767 97.70% 0.00% 0.00% 2.35% NA
Tropical Japonica  504 84.70% 0.00% 0.79% 14.48% NA
Japonica Intermediate  241 84.20% 0.00% 3.32% 12.45% NA
VI/Aromatic  96 19.80% 0.00% 5.21% 75.00% NA
Intermediate  90 66.70% 0.00% 1.11% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1012242711 G -> C LOC_Os10g23860.1 upstream_gene_variant ; 4287.0bp to feature; MODIFIER silent_mutation Average:9.407; most accessible tissue: Callus, score: 18.787 N N N N
vg1012242711 G -> C LOC_Os10g23870.1 upstream_gene_variant ; 1289.0bp to feature; MODIFIER silent_mutation Average:9.407; most accessible tissue: Callus, score: 18.787 N N N N
vg1012242711 G -> C LOC_Os10g23880.1 downstream_gene_variant ; 2842.0bp to feature; MODIFIER silent_mutation Average:9.407; most accessible tissue: Callus, score: 18.787 N N N N
vg1012242711 G -> C LOC_Os10g23870-LOC_Os10g23880 intergenic_region ; MODIFIER silent_mutation Average:9.407; most accessible tissue: Callus, score: 18.787 N N N N
vg1012242711 G -> DEL N N silent_mutation Average:9.407; most accessible tissue: Callus, score: 18.787 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1012242711 4.56E-06 NA mr1501 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012242711 3.72E-06 3.72E-06 mr1501 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251