\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1012018661:

Variant ID: vg1012018661 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 12018661
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


GTTCCCACCATTAGTTAAAATTTGAATTCTTGAATCGTTAAATGCCATTCCCAAGCTTCTGGATGGTTAAGGGGTTGTTCACTTTGATGCCAAAATAAAT[C/T]
TTATCAAGATTGACAGTATTGCCAAATTTTAGCAAGATAGCTAGCTATTTTGGATGCGTTCACTTTGTTGGAACCATACATGCTACCCAATTTTAGTCAT

Reverse complement sequence

ATGACTAAAATTGGGTAGCATGTATGGTTCCAACAAAGTGAACGCATCCAAAATAGCTAGCTATCTTGCTAAAATTTGGCAATACTGTCAATCTTGATAA[G/A]
ATTTATTTTGGCATCAAAGTGAACAACCCCTTAACCATCCAGAAGCTTGGGAATGGCATTTAACGATTCAAGAATTCAAATTTTAACTAATGGTGGGAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.00% 9.30% 0.72% 0.00% NA
All Indica  2759 83.10% 15.70% 1.20% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.50% 0.80% 0.67% 0.00% NA
Indica II  465 81.30% 17.80% 0.86% 0.00% NA
Indica III  913 72.20% 26.80% 0.99% 0.00% NA
Indica Intermediate  786 85.40% 12.60% 2.04% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1012018661 C -> T LOC_Os10g23060.1 upstream_gene_variant ; 3111.0bp to feature; MODIFIER silent_mutation Average:34.197; most accessible tissue: Minghui63 root, score: 63.193 N N N N
vg1012018661 C -> T LOC_Os10g23050.1 downstream_gene_variant ; 916.0bp to feature; MODIFIER silent_mutation Average:34.197; most accessible tissue: Minghui63 root, score: 63.193 N N N N
vg1012018661 C -> T LOC_Os10g23050-LOC_Os10g23060 intergenic_region ; MODIFIER silent_mutation Average:34.197; most accessible tissue: Minghui63 root, score: 63.193 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1012018661 NA 4.76E-07 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012018661 NA 1.93E-06 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012018661 NA 5.22E-06 mr1261 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012018661 NA 6.31E-08 mr1807 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012018661 NA 8.47E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012018661 NA 7.46E-06 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1012018661 NA 1.43E-06 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251