Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1011837512:

Variant ID: vg1011837512 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 11837512
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

TCATCGAAAGGCCCGGGACACCCGGCCCAGAGTGTTCGATTCCACCGATCGAGAACGCCGATCGCCTCCAGCTTCAATCAACCCGAGCGTGCGGCCGCAC[G/A]
TCTCCCTGTCGAGAGTAGCTCACTGGAAAGTTCGAGCCACCCGCCCGAAGTGTCCAACCCACCGATTGATTCGCCAATCGCTTCCGCCGCCATCAACCTG

Reverse complement sequence

CAGGTTGATGGCGGCGGAAGCGATTGGCGAATCAATCGGTGGGTTGGACACTTCGGGCGGGTGGCTCGAACTTTCCAGTGAGCTACTCTCGACAGGGAGA[C/T]
GTGCGGCCGCACGCTCGGGTTGATTGAAGCTGGAGGCGATCGGCGTTCTCGATCGGTGGAATCGAACACTCTGGGCCGGGTGTCCCGGGCCTTTCGATGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.30%	10.00%	0.17%	0.49%	NA
All Indica	2759	82.60%	16.20%	0.29%	0.83%	NA
All Japonica	1512	98.90%	1.10%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.00%	0.80%	0.00%	0.17%	NA
Indica II	465	61.10%	37.60%	0.65%	0.65%	NA
Indica III	913	79.30%	18.50%	0.44%	1.75%	NA
Indica Intermediate	786	86.90%	12.60%	0.13%	0.38%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	97.60%	2.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1011837512	G -> A	LOC_Os10g22780.1	upstream_gene_variant ; 3625.0bp to feature; MODIFIER	silent_mutation	Average:56.853; most accessible tissue: Minghui63 young leaf, score: 75.479	N	N	N	N
vg1011837512	G -> A	LOC_Os10g22770.1	intron_variant ; MODIFIER	silent_mutation	Average:56.853; most accessible tissue: Minghui63 young leaf, score: 75.479	N	N	N	N
vg1011837512	G -> DEL	N	N	silent_mutation	Average:56.853; most accessible tissue: Minghui63 young leaf, score: 75.479	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1011837512	NA	1.52E-09	mr1023	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011837512	2.27E-06	5.12E-12	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011837512	NA	6.20E-11	mr1142	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011837512	NA	4.77E-13	mr1178	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011837512	1.78E-06	2.45E-10	mr1489	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011837512	NA	3.42E-11	mr1490	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011837512	NA	2.31E-11	mr1491	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011837512	NA	2.52E-12	mr1132_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011837512	NA	8.12E-06	mr1323_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011837512	3.21E-06	3.82E-07	mr1336_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011837512	NA	3.41E-08	mr1489_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011837512	NA	9.78E-09	mr1805_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011837512	NA	4.37E-06	mr1994_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251