\
| Variant ID: vg1011837512 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 11837512 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 116. )
TCATCGAAAGGCCCGGGACACCCGGCCCAGAGTGTTCGATTCCACCGATCGAGAACGCCGATCGCCTCCAGCTTCAATCAACCCGAGCGTGCGGCCGCAC[G/A]
TCTCCCTGTCGAGAGTAGCTCACTGGAAAGTTCGAGCCACCCGCCCGAAGTGTCCAACCCACCGATTGATTCGCCAATCGCTTCCGCCGCCATCAACCTG
CAGGTTGATGGCGGCGGAAGCGATTGGCGAATCAATCGGTGGGTTGGACACTTCGGGCGGGTGGCTCGAACTTTCCAGTGAGCTACTCTCGACAGGGAGA[C/T]
GTGCGGCCGCACGCTCGGGTTGATTGAAGCTGGAGGCGATCGGCGTTCTCGATCGGTGGAATCGAACACTCTGGGCCGGGTGTCCCGGGCCTTTCGATGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.30% | 10.00% | 0.17% | 0.49% | NA |
| All Indica | 2759 | 82.60% | 16.20% | 0.29% | 0.83% | NA |
| All Japonica | 1512 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 0.80% | 0.00% | 0.17% | NA |
| Indica II | 465 | 61.10% | 37.60% | 0.65% | 0.65% | NA |
| Indica III | 913 | 79.30% | 18.50% | 0.44% | 1.75% | NA |
| Indica Intermediate | 786 | 86.90% | 12.60% | 0.13% | 0.38% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1011837512 | G -> A | LOC_Os10g22780.1 | upstream_gene_variant ; 3625.0bp to feature; MODIFIER | silent_mutation | Average:56.853; most accessible tissue: Minghui63 young leaf, score: 75.479 | N | N | N | N |
| vg1011837512 | G -> A | LOC_Os10g22770.1 | intron_variant ; MODIFIER | silent_mutation | Average:56.853; most accessible tissue: Minghui63 young leaf, score: 75.479 | N | N | N | N |
| vg1011837512 | G -> DEL | N | N | silent_mutation | Average:56.853; most accessible tissue: Minghui63 young leaf, score: 75.479 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1011837512 | NA | 1.52E-09 | mr1023 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011837512 | 2.27E-06 | 5.12E-12 | mr1132 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011837512 | NA | 6.20E-11 | mr1142 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011837512 | NA | 4.77E-13 | mr1178 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011837512 | 1.78E-06 | 2.45E-10 | mr1489 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011837512 | NA | 3.42E-11 | mr1490 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011837512 | NA | 2.31E-11 | mr1491 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011837512 | NA | 2.52E-12 | mr1132_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011837512 | NA | 8.12E-06 | mr1323_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011837512 | 3.21E-06 | 3.82E-07 | mr1336_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011837512 | NA | 3.41E-08 | mr1489_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011837512 | NA | 9.78E-09 | mr1805_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011837512 | NA | 4.37E-06 | mr1994_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |