\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011837512:

Variant ID: vg1011837512 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 11837512
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


TCATCGAAAGGCCCGGGACACCCGGCCCAGAGTGTTCGATTCCACCGATCGAGAACGCCGATCGCCTCCAGCTTCAATCAACCCGAGCGTGCGGCCGCAC[G/A]
TCTCCCTGTCGAGAGTAGCTCACTGGAAAGTTCGAGCCACCCGCCCGAAGTGTCCAACCCACCGATTGATTCGCCAATCGCTTCCGCCGCCATCAACCTG

Reverse complement sequence

CAGGTTGATGGCGGCGGAAGCGATTGGCGAATCAATCGGTGGGTTGGACACTTCGGGCGGGTGGCTCGAACTTTCCAGTGAGCTACTCTCGACAGGGAGA[C/T]
GTGCGGCCGCACGCTCGGGTTGATTGAAGCTGGAGGCGATCGGCGTTCTCGATCGGTGGAATCGAACACTCTGGGCCGGGTGTCCCGGGCCTTTCGATGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.30% 10.00% 0.17% 0.49% NA
All Indica  2759 82.60% 16.20% 0.29% 0.83% NA
All Japonica  1512 98.90% 1.10% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.00% 0.80% 0.00% 0.17% NA
Indica II  465 61.10% 37.60% 0.65% 0.65% NA
Indica III  913 79.30% 18.50% 0.44% 1.75% NA
Indica Intermediate  786 86.90% 12.60% 0.13% 0.38% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 97.60% 2.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011837512 G -> A LOC_Os10g22780.1 upstream_gene_variant ; 3625.0bp to feature; MODIFIER silent_mutation Average:56.853; most accessible tissue: Minghui63 young leaf, score: 75.479 N N N N
vg1011837512 G -> A LOC_Os10g22770.1 intron_variant ; MODIFIER silent_mutation Average:56.853; most accessible tissue: Minghui63 young leaf, score: 75.479 N N N N
vg1011837512 G -> DEL N N silent_mutation Average:56.853; most accessible tissue: Minghui63 young leaf, score: 75.479 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011837512 NA 1.52E-09 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011837512 2.27E-06 5.12E-12 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011837512 NA 6.20E-11 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011837512 NA 4.77E-13 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011837512 1.78E-06 2.45E-10 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011837512 NA 3.42E-11 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011837512 NA 2.31E-11 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011837512 NA 2.52E-12 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011837512 NA 8.12E-06 mr1323_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011837512 3.21E-06 3.82E-07 mr1336_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011837512 NA 3.41E-08 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011837512 NA 9.78E-09 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011837512 NA 4.37E-06 mr1994_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251