| Variant ID: vg1011562893 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 11562893 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 286. )
CAAGGGAACGAACAAATTAATCAAAGCACAAATAGAATGTACAAGACGTAAAGGCACATAACAGCATATCAAGATCTTTTGTGAAATAATGAAAGAAGTA[C/G]
GAAAATACAAATTAAGATGCATGCAGACGCATCATGCATAATTATGGATGTAAATAGCTAACTTGCGAATTCACTTATAGATTAAAAATAGTATATAAGT
ACTTATATACTATTTTTAATCTATAAGTGAATTCGCAAGTTAGCTATTTACATCCATAATTATGCATGATGCGTCTGCATGCATCTTAATTTGTATTTTC[G/C]
TACTTCTTTCATTATTTCACAAAAGATCTTGATATGCTGTTATGTGCCTTTACGTCTTGTACATTCTATTTGTGCTTTGATTAATTTGTTCGTTCCCTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.50% | 12.80% | 0.28% | 17.44% | NA |
| All Indica | 2759 | 69.50% | 0.80% | 0.43% | 29.29% | NA |
| All Japonica | 1512 | 62.20% | 37.40% | 0.00% | 0.33% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 50.10% | 0.70% | 0.67% | 48.57% | NA |
| Indica II | 465 | 55.70% | 1.50% | 0.43% | 42.37% | NA |
| Indica III | 913 | 87.10% | 0.30% | 0.33% | 12.27% | NA |
| Indica Intermediate | 786 | 71.90% | 1.00% | 0.38% | 26.72% | NA |
| Temperate Japonica | 767 | 27.40% | 72.40% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 99.60% | 0.20% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 95.00% | 4.10% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 12.20% | 1.11% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1011562893 | C -> G | LOC_Os10g22350.1 | upstream_gene_variant ; 1725.0bp to feature; MODIFIER | silent_mutation | Average:12.584; most accessible tissue: Callus, score: 72.553 | N | N | N | N |
| vg1011562893 | C -> G | LOC_Os10g22356.1 | upstream_gene_variant ; 4035.0bp to feature; MODIFIER | silent_mutation | Average:12.584; most accessible tissue: Callus, score: 72.553 | N | N | N | N |
| vg1011562893 | C -> G | LOC_Os10g22350-LOC_Os10g22356 | intergenic_region ; MODIFIER | silent_mutation | Average:12.584; most accessible tissue: Callus, score: 72.553 | N | N | N | N |
| vg1011562893 | C -> DEL | N | N | silent_mutation | Average:12.584; most accessible tissue: Callus, score: 72.553 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1011562893 | 1.37E-07 | NA | mr1354 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011562893 | NA | 1.10E-09 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011562893 | NA | 1.57E-06 | mr1570 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011562893 | NA | 6.78E-08 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011562893 | NA | 9.58E-12 | mr1650 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011562893 | NA | 5.01E-10 | mr1959 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011562893 | NA | 7.89E-06 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011562893 | NA | 1.46E-09 | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011562893 | NA | 7.62E-07 | mr1570_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |