Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1011562893:

Variant ID: vg1011562893 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 11562893
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

CAAGGGAACGAACAAATTAATCAAAGCACAAATAGAATGTACAAGACGTAAAGGCACATAACAGCATATCAAGATCTTTTGTGAAATAATGAAAGAAGTA[C/G]
GAAAATACAAATTAAGATGCATGCAGACGCATCATGCATAATTATGGATGTAAATAGCTAACTTGCGAATTCACTTATAGATTAAAAATAGTATATAAGT

Reverse complement sequence

ACTTATATACTATTTTTAATCTATAAGTGAATTCGCAAGTTAGCTATTTACATCCATAATTATGCATGATGCGTCTGCATGCATCTTAATTTGTATTTTC[G/C]
TACTTCTTTCATTATTTCACAAAAGATCTTGATATGCTGTTATGTGCCTTTACGTCTTGTACATTCTATTTGTGCTTTGATTAATTTGTTCGTTCCCTTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.50%	12.80%	0.28%	17.44%	NA
All Indica	2759	69.50%	0.80%	0.43%	29.29%	NA
All Japonica	1512	62.20%	37.40%	0.00%	0.33%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	50.10%	0.70%	0.67%	48.57%	NA
Indica II	465	55.70%	1.50%	0.43%	42.37%	NA
Indica III	913	87.10%	0.30%	0.33%	12.27%	NA
Indica Intermediate	786	71.90%	1.00%	0.38%	26.72%	NA
Temperate Japonica	767	27.40%	72.40%	0.00%	0.26%	NA
Tropical Japonica	504	99.60%	0.20%	0.00%	0.20%	NA
Japonica Intermediate	241	95.00%	4.10%	0.00%	0.83%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	75.60%	12.20%	1.11%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1011562893	C -> G	LOC_Os10g22350.1	upstream_gene_variant ; 1725.0bp to feature; MODIFIER	silent_mutation	Average:12.584; most accessible tissue: Callus, score: 72.553	N	N	N	N
vg1011562893	C -> G	LOC_Os10g22356.1	upstream_gene_variant ; 4035.0bp to feature; MODIFIER	silent_mutation	Average:12.584; most accessible tissue: Callus, score: 72.553	N	N	N	N
vg1011562893	C -> G	LOC_Os10g22350-LOC_Os10g22356	intergenic_region ; MODIFIER	silent_mutation	Average:12.584; most accessible tissue: Callus, score: 72.553	N	N	N	N
vg1011562893	C -> DEL	N	N	silent_mutation	Average:12.584; most accessible tissue: Callus, score: 72.553	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1011562893	1.37E-07	NA	mr1354	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011562893	NA	1.10E-09	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011562893	NA	1.57E-06	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011562893	NA	6.78E-08	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011562893	NA	9.58E-12	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011562893	NA	5.01E-10	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011562893	NA	7.89E-06	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011562893	NA	1.46E-09	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011562893	NA	7.62E-07	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251