\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011562893:

Variant ID: vg1011562893 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 11562893
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGGGAACGAACAAATTAATCAAAGCACAAATAGAATGTACAAGACGTAAAGGCACATAACAGCATATCAAGATCTTTTGTGAAATAATGAAAGAAGTA[C/G]
GAAAATACAAATTAAGATGCATGCAGACGCATCATGCATAATTATGGATGTAAATAGCTAACTTGCGAATTCACTTATAGATTAAAAATAGTATATAAGT

Reverse complement sequence

ACTTATATACTATTTTTAATCTATAAGTGAATTCGCAAGTTAGCTATTTACATCCATAATTATGCATGATGCGTCTGCATGCATCTTAATTTGTATTTTC[G/C]
TACTTCTTTCATTATTTCACAAAAGATCTTGATATGCTGTTATGTGCCTTTACGTCTTGTACATTCTATTTGTGCTTTGATTAATTTGTTCGTTCCCTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.50% 12.80% 0.28% 17.44% NA
All Indica  2759 69.50% 0.80% 0.43% 29.29% NA
All Japonica  1512 62.20% 37.40% 0.00% 0.33% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 50.10% 0.70% 0.67% 48.57% NA
Indica II  465 55.70% 1.50% 0.43% 42.37% NA
Indica III  913 87.10% 0.30% 0.33% 12.27% NA
Indica Intermediate  786 71.90% 1.00% 0.38% 26.72% NA
Temperate Japonica  767 27.40% 72.40% 0.00% 0.26% NA
Tropical Japonica  504 99.60% 0.20% 0.00% 0.20% NA
Japonica Intermediate  241 95.00% 4.10% 0.00% 0.83% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 75.60% 12.20% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011562893 C -> G LOC_Os10g22350.1 upstream_gene_variant ; 1725.0bp to feature; MODIFIER silent_mutation Average:12.584; most accessible tissue: Callus, score: 72.553 N N N N
vg1011562893 C -> G LOC_Os10g22356.1 upstream_gene_variant ; 4035.0bp to feature; MODIFIER silent_mutation Average:12.584; most accessible tissue: Callus, score: 72.553 N N N N
vg1011562893 C -> G LOC_Os10g22350-LOC_Os10g22356 intergenic_region ; MODIFIER silent_mutation Average:12.584; most accessible tissue: Callus, score: 72.553 N N N N
vg1011562893 C -> DEL N N silent_mutation Average:12.584; most accessible tissue: Callus, score: 72.553 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011562893 1.37E-07 NA mr1354 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011562893 NA 1.10E-09 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011562893 NA 1.57E-06 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011562893 NA 6.78E-08 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011562893 NA 9.58E-12 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011562893 NA 5.01E-10 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011562893 NA 7.89E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011562893 NA 1.46E-09 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011562893 NA 7.62E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251