\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011511526:

Variant ID: vg1011511526 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 11511526
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.02, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


TCATCACCAACTTTCAGGGCACCTTCGAACGTCCTGGCACCCACGAGCTCTACAATGTGATCAAGAAGCCCGGTGAATCCCTTCGGGATTATATCCGACG[C/T]
TTTTCTGAGCAACGCAATAAGATCTCTGACATTACCGACGATGTCATCATTGCCACTTTCACTAAGGGTGTTCGTCATGAACTCTTAGTCGGCAAATTCG

Reverse complement sequence

CGAATTTGCCGACTAAGAGTTCATGACGAACACCCTTAGTGAAAGTGGCAATGATGACATCGTCGGTAATGTCAGAGATCTTATTGCGTTGCTCAGAAAA[G/A]
CGTCGGATATAATCCCGAAGGGATTCACCGGGCTTCTTGATCACATTGTAGAGCTCGTGGGTGCCAGGACGTTCGAAGGTGCCCTGAAAGTTGGTGATGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.20% 26.00% 5.73% 26.07% NA
All Indica  2759 35.70% 35.80% 5.84% 22.58% NA
All Japonica  1512 55.10% 11.80% 6.68% 26.39% NA
Aus  269 15.60% 15.60% 2.23% 66.54% NA
Indica I  595 50.10% 35.10% 3.19% 11.60% NA
Indica II  465 30.80% 41.50% 4.09% 23.66% NA
Indica III  913 31.20% 31.80% 7.67% 29.35% NA
Indica Intermediate  786 33.10% 37.80% 6.74% 22.39% NA
Temperate Japonica  767 87.90% 0.80% 2.61% 8.74% NA
Tropical Japonica  504 14.70% 30.60% 12.10% 42.66% NA
Japonica Intermediate  241 35.30% 7.90% 8.30% 48.55% NA
VI/Aromatic  96 85.40% 4.20% 0.00% 10.42% NA
Intermediate  90 55.60% 17.80% 3.33% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011511526 C -> T LOC_Os10g22240.1 synonymous_variant ; p.Arg416Arg; LOW synonymous_codon Average:25.794; most accessible tissue: Callus, score: 33.488 N N N N
vg1011511526 C -> DEL LOC_Os10g22240.1 N frameshift_variant Average:25.794; most accessible tissue: Callus, score: 33.488 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011511526 4.99E-06 9.56E-16 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511526 4.72E-06 5.87E-16 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511526 NA 1.83E-12 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511526 NA 1.11E-11 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511526 5.02E-07 1.21E-17 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511526 NA 7.33E-16 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511526 1.13E-06 5.68E-16 mr1178 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511526 NA 1.08E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511526 NA 5.58E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511526 1.96E-06 1.08E-15 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511526 NA 1.80E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511526 7.66E-07 6.73E-16 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511526 NA 8.05E-10 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511526 NA 5.80E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511526 NA 1.21E-06 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511526 NA 4.59E-11 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511526 NA 1.68E-14 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511526 NA 1.26E-17 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511526 2.33E-07 7.45E-22 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511526 NA 1.67E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511526 4.37E-06 2.60E-17 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511526 1.89E-06 4.46E-18 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011511526 NA 2.91E-10 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251