\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011427851:

Variant ID: vg1011427851 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 11427851
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, A: 0.23, others allele: 0.00, population size: 159. )

Flanking Sequence (100 bp) in Reference Genome:


CATTTGGGATGGTTTGTCCTTGTGATTTGTTAATAGTCATTGCGAAACTGAGACGTATTGGAAATTGCTTCCTCTTGAATTTGAAAGGTAGAGATATATC[A/G]
TCGGAGGGAGACAAAGGGATCCATGGGATGAACACCCTTTTGCTGGCATGTTGTCTACCAACAATCTTAGCATCAATTGCATTATCTTGAAAAGCTCTAA

Reverse complement sequence

TTAGAGCTTTTCAAGATAATGCAATTGATGCTAAGATTGTTGGTAGACAACATGCCAGCAAAAGGGTGTTCATCCCATGGATCCCTTTGTCTCCCTCCGA[T/C]
GATATATCTCTACCTTTCAAATTCAAGAGGAAGCAATTTCCAATACGTCTCAGTTTCGCAATGACTATTAACAAATCACAAGGACAAACCATCCCAAATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.50% 19.80% 11.66% 12.10% NA
All Indica  2759 78.00% 8.90% 3.77% 9.31% NA
All Japonica  1512 21.80% 41.90% 22.95% 13.29% NA
Aus  269 37.90% 6.30% 25.65% 30.11% NA
Indica I  595 78.80% 8.10% 3.70% 9.41% NA
Indica II  465 84.50% 5.40% 3.87% 6.24% NA
Indica III  913 75.60% 9.60% 3.72% 11.06% NA
Indica Intermediate  786 76.30% 10.80% 3.82% 9.03% NA
Temperate Japonica  767 13.40% 60.00% 14.08% 12.52% NA
Tropical Japonica  504 30.80% 25.00% 28.97% 15.28% NA
Japonica Intermediate  241 29.90% 19.90% 38.59% 11.62% NA
VI/Aromatic  96 40.60% 18.80% 18.75% 21.88% NA
Intermediate  90 51.10% 21.10% 14.44% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011427851 A -> G LOC_Os10g22130.1 synonymous_variant ; p.Asp776Asp; LOW synonymous_codon Average:11.693; most accessible tissue: Callus, score: 32.353 N N N N
vg1011427851 A -> DEL LOC_Os10g22130.1 N frameshift_variant Average:11.693; most accessible tissue: Callus, score: 32.353 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011427851 9.79E-06 9.79E-06 mr1085 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011427851 NA 4.32E-07 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011427851 NA 2.78E-08 mr1192 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011427851 NA 4.07E-07 mr1263 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011427851 NA 2.09E-08 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011427851 NA 6.02E-08 mr1289 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011427851 NA 4.07E-07 mr1451 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011427851 NA 6.07E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011427851 NA 5.14E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011427851 NA 6.05E-06 mr1775 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011427851 NA 8.09E-07 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011427851 NA 7.90E-06 mr1070_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011427851 NA 1.69E-06 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011427851 NA 1.37E-06 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011427851 NA 5.04E-06 mr1437_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251