\
| Variant ID: vg1011368532 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 11368532 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGGACGAGTCTTGATTCCCCCACTCAGCGGTAGCCCCTTTTCTCCTCCCGCCCTGTTTGCCGCACCTTGCTGCGGGTACGGTGTGGTGAAAGGCAAAATC[G/A]
CAGCTTGTGCGTGAGGTTGGGCCGTGGCATTCGACTGCCCGGTTCCAACTGGAGGTACTTGCTGAGCCACCATAGATGGGTCAAAAATTGGCTGCGACCA
TGGTCGCAGCCAATTTTTGACCCATCTATGGTGGCTCAGCAAGTACCTCCAGTTGGAACCGGGCAGTCGAATGCCACGGCCCAACCTCACGCACAAGCTG[C/T]
GATTTTGCCTTTCACCACACCGTACCCGCAGCAAGGTGCGGCAAACAGGGCGGGAGGAGAAAAGGGGCTACCGCTGAGTGGGGGAATCAAGACTCGTCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.50% | 1.30% | 5.14% | 37.09% | NA |
| All Indica | 2759 | 53.90% | 2.20% | 5.47% | 38.42% | NA |
| All Japonica | 1512 | 61.80% | 0.00% | 2.45% | 35.78% | NA |
| Aus | 269 | 48.00% | 0.40% | 15.99% | 35.69% | NA |
| Indica I | 595 | 35.00% | 1.00% | 3.87% | 60.17% | NA |
| Indica II | 465 | 64.70% | 1.50% | 4.09% | 29.68% | NA |
| Indica III | 913 | 61.40% | 3.80% | 6.57% | 28.15% | NA |
| Indica Intermediate | 786 | 53.20% | 1.50% | 6.23% | 39.06% | NA |
| Temperate Japonica | 767 | 72.50% | 0.00% | 0.91% | 26.60% | NA |
| Tropical Japonica | 504 | 54.60% | 0.00% | 4.76% | 40.67% | NA |
| Japonica Intermediate | 241 | 42.70% | 0.00% | 2.49% | 54.77% | NA |
| VI/Aromatic | 96 | 64.60% | 0.00% | 6.25% | 29.17% | NA |
| Intermediate | 90 | 61.10% | 1.10% | 6.67% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1011368532 | G -> A | LOC_Os10g22010.1 | missense_variant ; p.Ala472Val; MODERATE | nonsynonymous_codon ; A472V | Average:13.026; most accessible tissue: Callus, score: 28.846 | benign |
0.572 |
TOLERATED | 0.60 |
| vg1011368532 | G -> DEL | LOC_Os10g22010.1 | N | frameshift_variant | Average:13.026; most accessible tissue: Callus, score: 28.846 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1011368532 | 7.31E-06 | 1.49E-07 | mr1080 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011368532 | NA | 3.54E-06 | mr1140 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011368532 | NA | 4.78E-06 | mr1203 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011368532 | 4.38E-08 | 2.68E-10 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011368532 | 9.66E-07 | 4.91E-09 | mr1309 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011368532 | NA | 4.08E-07 | mr1613 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011368532 | NA | 8.67E-06 | mr1618 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011368532 | 9.01E-06 | 1.37E-06 | mr1795 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011368532 | NA | 1.39E-07 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011368532 | 2.28E-06 | 2.28E-06 | mr1900 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011368532 | NA | 7.98E-07 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011368532 | NA | 7.70E-07 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011368532 | NA | 3.49E-09 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1011368532 | NA | 1.27E-08 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |