\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011329733:

Variant ID: vg1011329733 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 11329733
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGGATTCATAAGGCTTCCCTTAAACCTATGCCGGCTACATGTTCCTTGAACATGTTGGGTGGTAGGCCTTTCGTGAGCGGATCCGCGAGCATCCTTTCT[A/G]
TTCTAATGTGCTCGAGACTGATTATTTGATCCCGGACTTTGTCCTTCACAACATAGTACTTTATGTCAATGTGTTTGGCAGCACCACTTGACTGATTGTT

Reverse complement sequence

AACAATCAGTCAAGTGGTGCTGCCAAACACATTGACATAAAGTACTATGTTGTGAAGGACAAAGTCCGGGATCAAATAATCAGTCTCGAGCACATTAGAA[T/C]
AGAAAGGATGCTCGCGGATCCGCTCACGAAAGGCCTACCACCCAACATGTTCAAGGAACATGTAGCCGGCATAGGTTTAAGGGAAGCCTTATGAATCCTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 15.20% 0.20% 1.99% 82.61% NA
All Indica  2759 2.10% 0.30% 2.25% 95.36% NA
All Japonica  1512 41.80% 0.10% 0.99% 57.14% NA
Aus  269 2.20% 0.00% 2.97% 94.80% NA
Indica I  595 2.90% 0.20% 1.51% 95.46% NA
Indica II  465 3.00% 0.60% 0.22% 96.13% NA
Indica III  913 0.90% 0.20% 3.07% 95.84% NA
Indica Intermediate  786 2.30% 0.40% 3.05% 94.27% NA
Temperate Japonica  767 68.60% 0.00% 0.65% 30.77% NA
Tropical Japonica  504 15.90% 0.00% 1.59% 82.54% NA
Japonica Intermediate  241 10.80% 0.40% 0.83% 87.97% NA
VI/Aromatic  96 7.30% 0.00% 3.12% 89.58% NA
Intermediate  90 17.80% 0.00% 6.67% 75.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011329733 A -> G LOC_Os10g21950.1 intron_variant ; MODIFIER silent_mutation Average:12.516; most accessible tissue: Minghui63 root, score: 21.615 N N N N
vg1011329733 A -> DEL N N silent_mutation Average:12.516; most accessible tissue: Minghui63 root, score: 21.615 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011329733 NA 4.05E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011329733 2.44E-06 2.44E-06 mr1877_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251