Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011249793:

Variant ID: vg1011249793 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 11249793
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

GAGCTGTAGGCCGAAGTCTCTTTGGCAGACCAGGGGTAAGCAGGTGTCCGAAGCAATCGATAGGGGTTTACCTTAACTTAATTAAAATAATTAACCCATA[G/A]
GAATCATCTCTATTCTCAACCTACCATTTAGTTGTTGTCCTTGGAAGAATCTTGTACTTAGATTATACAAACACGTTCCCTGTGGATACGATACCCTGGA

Reverse complement sequence

TCCAGGGTATCGTATCCACAGGGAACGTGTTTGTATAATCTAAGTACAAGATTCTTCCAAGGACAACAACTAAATGGTAGGTTGAGAATAGAGATGATTC[C/T]
TATGGGTTAATTATTTTAATTAAGTTAAGGTAAACCCCTATCGATTGCTTCGGACACCTGCTTACCCCTGGTCTGCCAAAGAGACTTCGGCCTACAGCTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.40%	10.40%	0.06%	0.06%	NA
All Indica	2759	95.30%	4.50%	0.11%	0.11%	NA
All Japonica	1512	99.40%	0.60%	0.00%	0.00%	NA
Aus	269	0.70%	99.30%	0.00%	0.00%	NA
Indica I	595	97.50%	2.50%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	94.20%	5.30%	0.22%	0.33%	NA
Indica Intermediate	786	92.60%	7.30%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	97.10%	2.90%	0.00%	0.00%	NA
VI/Aromatic	96	18.80%	81.20%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1011249793	G -> A	LOC_Os10g21870.1	upstream_gene_variant ; 3429.0bp to feature; MODIFIER	silent_mutation	Average:64.089; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N
vg1011249793	G -> A	LOC_Os10g21880.1	upstream_gene_variant ; 1583.0bp to feature; MODIFIER	silent_mutation	Average:64.089; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N
vg1011249793	G -> A	LOC_Os10g21890.1	upstream_gene_variant ; 1084.0bp to feature; MODIFIER	silent_mutation	Average:64.089; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N
vg1011249793	G -> A	LOC_Os10g21890.2	upstream_gene_variant ; 1131.0bp to feature; MODIFIER	silent_mutation	Average:64.089; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N
vg1011249793	G -> A	LOC_Os10g21860.1	downstream_gene_variant ; 4767.0bp to feature; MODIFIER	silent_mutation	Average:64.089; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N
vg1011249793	G -> A	LOC_Os10g21880-LOC_Os10g21890	intergenic_region ; MODIFIER	silent_mutation	Average:64.089; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N
vg1011249793	G -> DEL	N	N	silent_mutation	Average:64.089; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1011249793	NA	3.83E-17	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1011249793	NA	2.76E-23	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793	NA	1.31E-14	mr1231	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793	NA	3.97E-27	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793	NA	6.93E-13	mr1522	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793	NA	1.40E-10	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793	NA	2.70E-27	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793	NA	4.57E-18	mr1765	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793	NA	1.60E-06	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793	NA	6.72E-17	mr1911	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793	NA	1.49E-10	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793	NA	3.24E-08	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793	NA	4.29E-24	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793	NA	1.88E-11	mr1409_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793	NA	1.61E-06	mr1522_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793	NA	3.69E-08	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793	3.66E-06	NA	mr1598_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793	NA	1.27E-08	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793	NA	1.54E-08	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793	NA	7.75E-07	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793	NA	3.27E-13	mr1803_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793	NA	4.46E-07	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793	NA	8.90E-15	mr1911_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793	NA	3.25E-10	mr1942_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251