\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011249793:

Variant ID: vg1011249793 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 11249793
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


GAGCTGTAGGCCGAAGTCTCTTTGGCAGACCAGGGGTAAGCAGGTGTCCGAAGCAATCGATAGGGGTTTACCTTAACTTAATTAAAATAATTAACCCATA[G/A]
GAATCATCTCTATTCTCAACCTACCATTTAGTTGTTGTCCTTGGAAGAATCTTGTACTTAGATTATACAAACACGTTCCCTGTGGATACGATACCCTGGA

Reverse complement sequence

TCCAGGGTATCGTATCCACAGGGAACGTGTTTGTATAATCTAAGTACAAGATTCTTCCAAGGACAACAACTAAATGGTAGGTTGAGAATAGAGATGATTC[C/T]
TATGGGTTAATTATTTTAATTAAGTTAAGGTAAACCCCTATCGATTGCTTCGGACACCTGCTTACCCCTGGTCTGCCAAAGAGACTTCGGCCTACAGCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.40% 10.40% 0.06% 0.06% NA
All Indica  2759 95.30% 4.50% 0.11% 0.11% NA
All Japonica  1512 99.40% 0.60% 0.00% 0.00% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 97.50% 2.50% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 94.20% 5.30% 0.22% 0.33% NA
Indica Intermediate  786 92.60% 7.30% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 18.80% 81.20% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011249793 G -> A LOC_Os10g21870.1 upstream_gene_variant ; 3429.0bp to feature; MODIFIER silent_mutation Average:64.089; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg1011249793 G -> A LOC_Os10g21880.1 upstream_gene_variant ; 1583.0bp to feature; MODIFIER silent_mutation Average:64.089; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg1011249793 G -> A LOC_Os10g21890.1 upstream_gene_variant ; 1084.0bp to feature; MODIFIER silent_mutation Average:64.089; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg1011249793 G -> A LOC_Os10g21890.2 upstream_gene_variant ; 1131.0bp to feature; MODIFIER silent_mutation Average:64.089; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg1011249793 G -> A LOC_Os10g21860.1 downstream_gene_variant ; 4767.0bp to feature; MODIFIER silent_mutation Average:64.089; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg1011249793 G -> A LOC_Os10g21880-LOC_Os10g21890 intergenic_region ; MODIFIER silent_mutation Average:64.089; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg1011249793 G -> DEL N N silent_mutation Average:64.089; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011249793 NA 3.83E-17 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1011249793 NA 2.76E-23 mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793 NA 1.31E-14 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793 NA 3.97E-27 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793 NA 6.93E-13 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793 NA 1.40E-10 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793 NA 2.70E-27 mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793 NA 4.57E-18 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793 NA 1.60E-06 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793 NA 6.72E-17 mr1911 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793 NA 1.49E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793 NA 3.24E-08 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793 NA 4.29E-24 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793 NA 1.88E-11 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793 NA 1.61E-06 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793 NA 3.69E-08 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793 3.66E-06 NA mr1598_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793 NA 1.27E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793 NA 1.54E-08 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793 NA 7.75E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793 NA 3.27E-13 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793 NA 4.46E-07 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793 NA 8.90E-15 mr1911_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011249793 NA 3.25E-10 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251