Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1011087195:

Variant ID: vg1011087195 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 11087195
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

AGGATACATCATTGCTATAGATATTTCCAGTGTAAAACGTTATCGGTCAAAAATGATAGTGGAAGTCTTGTACTTCCCGATTTCGTACGAATTTGAGGCA[A/G]
ACATATGTGTTGACTAATATAATGGAATGGACTTCCATTGTCGAGGAAGTTACCACGTAAATTTGTTCTTGCTTTTCTACACTTTTTTTTTTGAACATTC

Reverse complement sequence

GAATGTTCAAAAAAAAAAGTGTAGAAAAGCAAGAACAAATTTACGTGGTAACTTCCTCGACAATGGAAGTCCATTCCATTATATTAGTCAACACATATGT[T/C]
TGCCTCAAATTCGTACGAAATCGGGAAGTACAAGACTTCCACTATCATTTTTGACCGATAACGTTTTACACTGGAAATATCTATAGCAATGATGTATCCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.50%	19.40%	0.04%	0.00%	NA
All Indica	2759	98.40%	1.60%	0.00%	0.00%	NA
All Japonica	1512	44.00%	55.90%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	94.80%	5.20%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.00%	1.00%	0.00%	0.00%	NA
Temperate Japonica	767	12.00%	87.70%	0.26%	0.00%	NA
Tropical Japonica	504	92.70%	7.30%	0.00%	0.00%	NA
Japonica Intermediate	241	44.00%	56.00%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	75.60%	24.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1011087195	A -> G	LOC_Os10g21640.1	upstream_gene_variant ; 2605.0bp to feature; MODIFIER	silent_mutation	Average:46.833; most accessible tissue: Callus, score: 73.793	N	N	N	N
vg1011087195	A -> G	LOC_Os10g21660.1	downstream_gene_variant ; 820.0bp to feature; MODIFIER	silent_mutation	Average:46.833; most accessible tissue: Callus, score: 73.793	N	N	N	N
vg1011087195	A -> G	LOC_Os10g21640-LOC_Os10g21660	intergenic_region ; MODIFIER	silent_mutation	Average:46.833; most accessible tissue: Callus, score: 73.793	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1011087195	NA	3.96E-07	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011087195	NA	3.76E-06	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011087195	2.80E-07	3.37E-26	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011087195	NA	1.75E-06	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011087195	6.81E-10	3.31E-44	mr1310	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011087195	NA	3.39E-09	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011087195	NA	4.23E-08	mr1624	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011087195	NA	4.46E-21	mr1679	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011087195	NA	3.83E-08	mr1691	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011087195	NA	3.50E-09	mr1693	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011087195	4.47E-10	7.37E-49	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011087195	NA	1.47E-09	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011087195	4.60E-07	9.01E-13	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011087195	NA	4.47E-06	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011087195	4.16E-07	2.70E-38	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011087195	NA	1.45E-08	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011087195	NA	3.60E-07	mr1495_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011087195	NA	2.89E-06	mr1705_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011087195	2.01E-07	4.73E-18	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011087195	NA	1.06E-06	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251