\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011062697:

Variant ID: vg1011062697 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 11062697
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCGCCACCGCCGACTAGTGTCCTCGTCTATACCGTTGGATGGTCACACCACCGTTGATGGACGTATTTGCTTTCACTGCCGGCTTGCCTTTGTCGCCGT[C/T]
GATTGGTGTCCTCGCCTATACGGTTGGTTAGTCACACCGCCATTGATGGGCGTCTACGCTTTGACCATCGACTGCCTTCACCGCCGCCAACCAGTTTCCT

Reverse complement sequence

AGGAAACTGGTTGGCGGCGGTGAAGGCAGTCGATGGTCAAAGCGTAGACGCCCATCAATGGCGGTGTGACTAACCAACCGTATAGGCGAGGACACCAATC[G/A]
ACGGCGACAAAGGCAAGCCGGCAGTGAAAGCAAATACGTCCATCAACGGTGGTGTGACCATCCAACGGTATAGACGAGGACACTAGTCGGCGGTGGCGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.80% 9.10% 0.49% 40.63% NA
All Indica  2759 28.40% 4.10% 0.80% 66.73% NA
All Japonica  1512 98.60% 0.50% 0.00% 0.93% NA
Aus  269 1.90% 97.80% 0.00% 0.37% NA
Indica I  595 24.20% 2.90% 0.50% 72.44% NA
Indica II  465 15.50% 1.10% 0.22% 83.23% NA
Indica III  913 34.20% 3.40% 0.66% 61.77% NA
Indica Intermediate  786 32.60% 7.50% 1.53% 58.40% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 98.40% 0.20% 0.00% 1.39% NA
Japonica Intermediate  241 95.40% 2.50% 0.00% 2.07% NA
VI/Aromatic  96 18.80% 34.40% 1.04% 45.83% NA
Intermediate  90 60.00% 17.80% 0.00% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011062697 C -> T LOC_Os10g21590.1 upstream_gene_variant ; 4952.0bp to feature; MODIFIER silent_mutation Average:14.653; most accessible tissue: Callus, score: 66.53 N N N N
vg1011062697 C -> T LOC_Os10g21600.1 downstream_gene_variant ; 2779.0bp to feature; MODIFIER silent_mutation Average:14.653; most accessible tissue: Callus, score: 66.53 N N N N
vg1011062697 C -> T LOC_Os10g21600-LOC_Os10g21620 intergenic_region ; MODIFIER silent_mutation Average:14.653; most accessible tissue: Callus, score: 66.53 N N N N
vg1011062697 C -> DEL N N silent_mutation Average:14.653; most accessible tissue: Callus, score: 66.53 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011062697 3.31E-07 4.78E-09 mr1086 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697 NA 1.14E-07 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697 NA 7.32E-07 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697 NA 5.67E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697 NA 9.21E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697 NA 1.57E-23 mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697 NA 3.01E-07 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697 NA 2.80E-14 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697 NA 2.68E-08 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697 NA 3.09E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697 NA 7.47E-28 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697 NA 7.89E-06 mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697 NA 8.34E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697 NA 3.48E-13 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697 NA 4.38E-12 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697 NA 3.09E-27 mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697 NA 1.15E-19 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697 NA 2.85E-06 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697 NA 9.61E-06 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697 NA 3.80E-17 mr1911 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697 NA 1.40E-20 mr1961 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697 NA 5.00E-23 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697 NA 1.56E-07 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697 NA 4.42E-08 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697 NA 2.59E-08 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697 NA 8.96E-12 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251