Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011062697:

Variant ID: vg1011062697 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 11062697
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCGCCACCGCCGACTAGTGTCCTCGTCTATACCGTTGGATGGTCACACCACCGTTGATGGACGTATTTGCTTTCACTGCCGGCTTGCCTTTGTCGCCGT[C/T]
GATTGGTGTCCTCGCCTATACGGTTGGTTAGTCACACCGCCATTGATGGGCGTCTACGCTTTGACCATCGACTGCCTTCACCGCCGCCAACCAGTTTCCT

Reverse complement sequence

AGGAAACTGGTTGGCGGCGGTGAAGGCAGTCGATGGTCAAAGCGTAGACGCCCATCAATGGCGGTGTGACTAACCAACCGTATAGGCGAGGACACCAATC[G/A]
ACGGCGACAAAGGCAAGCCGGCAGTGAAAGCAAATACGTCCATCAACGGTGGTGTGACCATCCAACGGTATAGACGAGGACACTAGTCGGCGGTGGCGAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.80%	9.10%	0.49%	40.63%	NA
All Indica	2759	28.40%	4.10%	0.80%	66.73%	NA
All Japonica	1512	98.60%	0.50%	0.00%	0.93%	NA
Aus	269	1.90%	97.80%	0.00%	0.37%	NA
Indica I	595	24.20%	2.90%	0.50%	72.44%	NA
Indica II	465	15.50%	1.10%	0.22%	83.23%	NA
Indica III	913	34.20%	3.40%	0.66%	61.77%	NA
Indica Intermediate	786	32.60%	7.50%	1.53%	58.40%	NA
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	98.40%	0.20%	0.00%	1.39%	NA
Japonica Intermediate	241	95.40%	2.50%	0.00%	2.07%	NA
VI/Aromatic	96	18.80%	34.40%	1.04%	45.83%	NA
Intermediate	90	60.00%	17.80%	0.00%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1011062697	C -> T	LOC_Os10g21590.1	upstream_gene_variant ; 4952.0bp to feature; MODIFIER	silent_mutation	Average:14.653; most accessible tissue: Callus, score: 66.53	N	N	N	N
vg1011062697	C -> T	LOC_Os10g21600.1	downstream_gene_variant ; 2779.0bp to feature; MODIFIER	silent_mutation	Average:14.653; most accessible tissue: Callus, score: 66.53	N	N	N	N
vg1011062697	C -> T	LOC_Os10g21600-LOC_Os10g21620	intergenic_region ; MODIFIER	silent_mutation	Average:14.653; most accessible tissue: Callus, score: 66.53	N	N	N	N
vg1011062697	C -> DEL	N	N	silent_mutation	Average:14.653; most accessible tissue: Callus, score: 66.53	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1011062697	3.31E-07	4.78E-09	mr1086	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697	NA	1.14E-07	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697	NA	7.32E-07	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697	NA	5.67E-06	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697	NA	9.21E-07	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697	NA	1.57E-23	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697	NA	3.01E-07	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697	NA	2.80E-14	mr1231	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697	NA	2.68E-08	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697	NA	3.09E-06	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697	NA	7.47E-28	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697	NA	7.89E-06	mr1404	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697	NA	8.34E-06	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697	NA	3.48E-13	mr1522	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697	NA	4.38E-12	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697	NA	3.09E-27	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697	NA	1.15E-19	mr1765	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697	NA	2.85E-06	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697	NA	9.61E-06	mr1808	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697	NA	3.80E-17	mr1911	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697	NA	1.40E-20	mr1961	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697	NA	5.00E-23	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697	NA	1.56E-07	mr1522_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697	NA	4.42E-08	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697	NA	2.59E-08	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011062697	NA	8.96E-12	mr1803_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251