\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011003755:

Variant ID: vg1011003755 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 11003755
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


CCCACTCCGCCTCGCCACCTCCATGTCGTCGTCGTCGTCGTCTGCATGTCCTTCCCCCTCTCCCGTTGCTCCAGCCTCCATCTCCGTCTCCTCCGCCATC[G/A]
AATTCCACACGCTCTACTACCACATCAAGGTGACGCGCACACCCTCTACGTGTATGCTTCTTGTTTGTGTTGTGGCGTGGGGATTGGCCGTGATGCCATT

Reverse complement sequence

AATGGCATCACGGCCAATCCCCACGCCACAACACAAACAAGAAGCATACACGTAGAGGGTGTGCGCGTCACCTTGATGTGGTAGTAGAGCGTGTGGAATT[C/T]
GATGGCGGAGGAGACGGAGATGGAGGCTGGAGCAACGGGAGAGGGGGAAGGACATGCAGACGACGACGACGACGACATGGAGGTGGCGAGGCGGAGTGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.60% 6.30% 0.40% 3.62% NA
All Indica  2759 90.20% 3.30% 0.62% 5.91% NA
All Japonica  1512 86.40% 13.40% 0.00% 0.20% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.80% 0.70% 0.17% 0.34% NA
Indica II  465 92.50% 0.40% 1.29% 5.81% NA
Indica III  913 86.90% 4.90% 0.33% 7.89% NA
Indica Intermediate  786 86.10% 5.10% 0.89% 7.89% NA
Temperate Japonica  767 81.50% 18.50% 0.00% 0.00% NA
Tropical Japonica  504 96.40% 3.20% 0.00% 0.40% NA
Japonica Intermediate  241 80.90% 18.70% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 6.70% 2.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011003755 G -> A LOC_Os10g21479.1 upstream_gene_variant ; 243.0bp to feature; MODIFIER silent_mutation Average:79.977; most accessible tissue: Zhenshan97 young leaf, score: 92.652 N N N N
vg1011003755 G -> A LOC_Os10g21490.1 downstream_gene_variant ; 3501.0bp to feature; MODIFIER silent_mutation Average:79.977; most accessible tissue: Zhenshan97 young leaf, score: 92.652 N N N N
vg1011003755 G -> A LOC_Os10g21479-LOC_Os10g21490 intergenic_region ; MODIFIER silent_mutation Average:79.977; most accessible tissue: Zhenshan97 young leaf, score: 92.652 N N N N
vg1011003755 G -> DEL N N silent_mutation Average:79.977; most accessible tissue: Zhenshan97 young leaf, score: 92.652 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011003755 1.64E-06 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003755 NA 4.67E-08 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003755 3.58E-07 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003755 NA 6.88E-09 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003755 NA 6.01E-10 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003755 2.65E-07 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003755 NA 1.96E-08 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003755 9.43E-07 9.43E-07 mr1166_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003755 3.00E-07 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003755 1.82E-06 2.65E-09 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003755 NA 4.68E-07 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003755 3.42E-06 NA mr1559_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003755 4.56E-07 7.02E-07 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003755 4.00E-10 1.36E-08 mr1585_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003755 5.97E-08 2.66E-13 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003755 NA 3.04E-06 mr1703_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003755 2.11E-08 NA mr1765_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011003755 2.91E-08 3.19E-11 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251