\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010999956:

Variant ID: vg1010999956 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10999956
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


AGGGACAGAACACAAGCGCTGCACGTGTTCGGCTTTGTCGCCGCCGCCGGCCAACCCAATGCTTTGTCGCTATCCAGGTCGAGACCAAGGGCAAACTTGT[T/C]
TTTATTTAGTGTTTCTCTCTCCAAATTCACGAGAAATAATAAAATAAGGCCCCGAGTGTCCAGGAGCTAATTACACGTTTTTTGTGATGCCCGTTAGCAA

Reverse complement sequence

TTGCTAACGGGCATCACAAAAAACGTGTAATTAGCTCCTGGACACTCGGGGCCTTATTTTATTATTTCTCGTGAATTTGGAGAGAGAAACACTAAATAAA[A/G]
ACAAGTTTGCCCTTGGTCTCGACCTGGATAGCGACAAAGCATTGGGTTGGCCGGCGGCGGCGACAAAGCCGAACACGTGCAGCGCTTGTGTTCTGTCCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.70% 15.70% 0.38% 40.22% NA
All Indica  2759 29.60% 2.10% 0.58% 67.67% NA
All Japonica  1512 55.10% 44.10% 0.00% 0.79% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 20.00% 5.90% 1.18% 72.94% NA
Indica II  465 14.40% 1.30% 0.43% 83.87% NA
Indica III  913 39.30% 0.70% 0.33% 59.69% NA
Indica Intermediate  786 34.70% 1.40% 0.51% 63.36% NA
Temperate Japonica  767 28.20% 71.40% 0.00% 0.39% NA
Tropical Japonica  504 92.50% 6.30% 0.00% 1.19% NA
Japonica Intermediate  241 62.70% 36.10% 0.00% 1.24% NA
VI/Aromatic  96 96.90% 2.10% 0.00% 1.04% NA
Intermediate  90 56.70% 18.90% 2.22% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010999956 T -> C LOC_Os10g21470.1 upstream_gene_variant ; 2571.0bp to feature; MODIFIER silent_mutation Average:17.317; most accessible tissue: Callus, score: 82.201 N N N N
vg1010999956 T -> C LOC_Os10g21470.2 upstream_gene_variant ; 2571.0bp to feature; MODIFIER silent_mutation Average:17.317; most accessible tissue: Callus, score: 82.201 N N N N
vg1010999956 T -> C LOC_Os10g21479.1 downstream_gene_variant ; 3098.0bp to feature; MODIFIER silent_mutation Average:17.317; most accessible tissue: Callus, score: 82.201 N N N N
vg1010999956 T -> C LOC_Os10g21470-LOC_Os10g21479 intergenic_region ; MODIFIER silent_mutation Average:17.317; most accessible tissue: Callus, score: 82.201 N N N N
vg1010999956 T -> DEL N N silent_mutation Average:17.317; most accessible tissue: Callus, score: 82.201 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010999956 NA 2.30E-06 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999956 4.42E-06 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999956 NA 5.07E-08 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999956 3.29E-06 2.17E-08 mr1559_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999956 1.50E-07 NA mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999956 NA 7.55E-08 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999956 NA 1.07E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999956 NA 1.18E-09 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999956 8.93E-07 2.83E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999956 3.19E-08 7.24E-06 mr1765_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999956 NA 1.40E-26 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010999956 NA 1.16E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251