| Variant ID: vg1010999956 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 10999956 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 109. )
AGGGACAGAACACAAGCGCTGCACGTGTTCGGCTTTGTCGCCGCCGCCGGCCAACCCAATGCTTTGTCGCTATCCAGGTCGAGACCAAGGGCAAACTTGT[T/C]
TTTATTTAGTGTTTCTCTCTCCAAATTCACGAGAAATAATAAAATAAGGCCCCGAGTGTCCAGGAGCTAATTACACGTTTTTTGTGATGCCCGTTAGCAA
TTGCTAACGGGCATCACAAAAAACGTGTAATTAGCTCCTGGACACTCGGGGCCTTATTTTATTATTTCTCGTGAATTTGGAGAGAGAAACACTAAATAAA[A/G]
ACAAGTTTGCCCTTGGTCTCGACCTGGATAGCGACAAAGCATTGGGTTGGCCGGCGGCGGCGACAAAGCCGAACACGTGCAGCGCTTGTGTTCTGTCCCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.70% | 15.70% | 0.38% | 40.22% | NA |
| All Indica | 2759 | 29.60% | 2.10% | 0.58% | 67.67% | NA |
| All Japonica | 1512 | 55.10% | 44.10% | 0.00% | 0.79% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 20.00% | 5.90% | 1.18% | 72.94% | NA |
| Indica II | 465 | 14.40% | 1.30% | 0.43% | 83.87% | NA |
| Indica III | 913 | 39.30% | 0.70% | 0.33% | 59.69% | NA |
| Indica Intermediate | 786 | 34.70% | 1.40% | 0.51% | 63.36% | NA |
| Temperate Japonica | 767 | 28.20% | 71.40% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 92.50% | 6.30% | 0.00% | 1.19% | NA |
| Japonica Intermediate | 241 | 62.70% | 36.10% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 96.90% | 2.10% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 56.70% | 18.90% | 2.22% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1010999956 | T -> C | LOC_Os10g21470.1 | upstream_gene_variant ; 2571.0bp to feature; MODIFIER | silent_mutation | Average:17.317; most accessible tissue: Callus, score: 82.201 | N | N | N | N |
| vg1010999956 | T -> C | LOC_Os10g21470.2 | upstream_gene_variant ; 2571.0bp to feature; MODIFIER | silent_mutation | Average:17.317; most accessible tissue: Callus, score: 82.201 | N | N | N | N |
| vg1010999956 | T -> C | LOC_Os10g21479.1 | downstream_gene_variant ; 3098.0bp to feature; MODIFIER | silent_mutation | Average:17.317; most accessible tissue: Callus, score: 82.201 | N | N | N | N |
| vg1010999956 | T -> C | LOC_Os10g21470-LOC_Os10g21479 | intergenic_region ; MODIFIER | silent_mutation | Average:17.317; most accessible tissue: Callus, score: 82.201 | N | N | N | N |
| vg1010999956 | T -> DEL | N | N | silent_mutation | Average:17.317; most accessible tissue: Callus, score: 82.201 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1010999956 | NA | 2.30E-06 | mr1138_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010999956 | 4.42E-06 | NA | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010999956 | NA | 5.07E-08 | mr1379_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010999956 | 3.29E-06 | 2.17E-08 | mr1559_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010999956 | 1.50E-07 | NA | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010999956 | NA | 7.55E-08 | mr1606_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010999956 | NA | 1.07E-06 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010999956 | NA | 1.18E-09 | mr1660_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010999956 | 8.93E-07 | 2.83E-08 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010999956 | 3.19E-08 | 7.24E-06 | mr1765_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010999956 | NA | 1.40E-26 | mr1768_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010999956 | NA | 1.16E-06 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |