\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010927325:

Variant ID: vg1010927325 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10927325
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTAGTCTGTAGAGACATCCAGAGGTCATACTTGCATGCTAAGCATAGGGTTTTGTCCTAGTGACAATAAGTTGGTCAGTGAACCAACCGATGTAATATG[T/C]
AGTGTAGCTGGTAAAAAAAAAGTAATAATAATAAACGGAACCACTGTTGTAGGTGTCCAAGCTCCAGTTGTGATGGTTAGACATTGCATCTTGCCTTGTA

Reverse complement sequence

TACAAGGCAAGATGCAATGTCTAACCATCACAACTGGAGCTTGGACACCTACAACAGTGGTTCCGTTTATTATTATTACTTTTTTTTTACCAGCTACACT[A/G]
CATATTACATCGGTTGGTTCACTGACCAACTTATTGTCACTAGGACAAAACCCTATGCTTAGCATGCAAGTATGACCTCTGGATGTCTCTACAGACTAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.90% 19.90% 2.86% 4.38% NA
All Indica  2759 94.60% 2.20% 2.54% 0.65% NA
All Japonica  1512 28.20% 55.50% 4.17% 12.17% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 95.60% 0.50% 2.02% 1.85% NA
Indica II  465 99.40% 0.40% 0.22% 0.00% NA
Indica III  913 92.00% 4.60% 3.18% 0.22% NA
Indica Intermediate  786 93.90% 1.90% 3.56% 0.64% NA
Temperate Japonica  767 34.20% 37.00% 6.13% 22.69% NA
Tropical Japonica  504 7.30% 91.30% 0.99% 0.40% NA
Japonica Intermediate  241 52.70% 39.40% 4.56% 3.32% NA
VI/Aromatic  96 88.50% 10.40% 0.00% 1.04% NA
Intermediate  90 67.80% 25.60% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010927325 T -> C LOC_Os10g21360.1 upstream_gene_variant ; 4856.0bp to feature; MODIFIER silent_mutation Average:45.664; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg1010927325 T -> C LOC_Os10g21360.2 upstream_gene_variant ; 4856.0bp to feature; MODIFIER silent_mutation Average:45.664; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg1010927325 T -> C LOC_Os10g21350.1 downstream_gene_variant ; 1354.0bp to feature; MODIFIER silent_mutation Average:45.664; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg1010927325 T -> C LOC_Os10g21350-LOC_Os10g21360 intergenic_region ; MODIFIER silent_mutation Average:45.664; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg1010927325 T -> DEL N N silent_mutation Average:45.664; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010927325 NA 8.84E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010927325 NA 2.88E-19 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010927325 NA 8.97E-08 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010927325 1.38E-06 6.66E-10 mr1645_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010927325 3.91E-06 3.91E-06 mr1645_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010927325 1.71E-06 5.52E-07 mr1647_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010927325 5.90E-06 5.90E-06 mr1647_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010927325 NA 1.23E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010927325 NA 9.24E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010927325 NA 1.06E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010927325 3.55E-06 3.55E-06 mr1756_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010927325 NA 2.86E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251