\
| Variant ID: vg1010927325 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 10927325 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTTAGTCTGTAGAGACATCCAGAGGTCATACTTGCATGCTAAGCATAGGGTTTTGTCCTAGTGACAATAAGTTGGTCAGTGAACCAACCGATGTAATATG[T/C]
AGTGTAGCTGGTAAAAAAAAAGTAATAATAATAAACGGAACCACTGTTGTAGGTGTCCAAGCTCCAGTTGTGATGGTTAGACATTGCATCTTGCCTTGTA
TACAAGGCAAGATGCAATGTCTAACCATCACAACTGGAGCTTGGACACCTACAACAGTGGTTCCGTTTATTATTATTACTTTTTTTTTACCAGCTACACT[A/G]
CATATTACATCGGTTGGTTCACTGACCAACTTATTGTCACTAGGACAAAACCCTATGCTTAGCATGCAAGTATGACCTCTGGATGTCTCTACAGACTAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.90% | 19.90% | 2.86% | 4.38% | NA |
| All Indica | 2759 | 94.60% | 2.20% | 2.54% | 0.65% | NA |
| All Japonica | 1512 | 28.20% | 55.50% | 4.17% | 12.17% | NA |
| Aus | 269 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.60% | 0.50% | 2.02% | 1.85% | NA |
| Indica II | 465 | 99.40% | 0.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 92.00% | 4.60% | 3.18% | 0.22% | NA |
| Indica Intermediate | 786 | 93.90% | 1.90% | 3.56% | 0.64% | NA |
| Temperate Japonica | 767 | 34.20% | 37.00% | 6.13% | 22.69% | NA |
| Tropical Japonica | 504 | 7.30% | 91.30% | 0.99% | 0.40% | NA |
| Japonica Intermediate | 241 | 52.70% | 39.40% | 4.56% | 3.32% | NA |
| VI/Aromatic | 96 | 88.50% | 10.40% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 67.80% | 25.60% | 2.22% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1010927325 | T -> C | LOC_Os10g21360.1 | upstream_gene_variant ; 4856.0bp to feature; MODIFIER | silent_mutation | Average:45.664; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg1010927325 | T -> C | LOC_Os10g21360.2 | upstream_gene_variant ; 4856.0bp to feature; MODIFIER | silent_mutation | Average:45.664; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg1010927325 | T -> C | LOC_Os10g21350.1 | downstream_gene_variant ; 1354.0bp to feature; MODIFIER | silent_mutation | Average:45.664; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg1010927325 | T -> C | LOC_Os10g21350-LOC_Os10g21360 | intergenic_region ; MODIFIER | silent_mutation | Average:45.664; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg1010927325 | T -> DEL | N | N | silent_mutation | Average:45.664; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1010927325 | NA | 8.84E-11 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010927325 | NA | 2.88E-19 | mr1715 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010927325 | NA | 8.97E-08 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010927325 | 1.38E-06 | 6.66E-10 | mr1645_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010927325 | 3.91E-06 | 3.91E-06 | mr1645_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010927325 | 1.71E-06 | 5.52E-07 | mr1647_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010927325 | 5.90E-06 | 5.90E-06 | mr1647_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010927325 | NA | 1.23E-06 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010927325 | NA | 9.24E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010927325 | NA | 1.06E-10 | mr1756_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010927325 | 3.55E-06 | 3.55E-06 | mr1756_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010927325 | NA | 2.86E-08 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |