\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010925312:

Variant ID: vg1010925312 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10925312
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


TTGCATCCTAGAATTTAAAGGATCATGGGAAGAATTTATGCCATTAGCAGAATTTGCATATAACAATAGTTATCAATCTAGTATACGAATGGCCCCGTAT[G/A]
AAGCCTTATATGGAAGGAAATGCAGAACACCTGTTTGCTGGAACGAAGTAGGAGAAAGAAAATTGCTAGGACCAGATATAATACAACAGACAAAAGAAAC

Reverse complement sequence

GTTTCTTTTGTCTGTTGTATTATATCTGGTCCTAGCAATTTTCTTTCTCCTACTTCGTTCCAGCAAACAGGTGTTCTGCATTTCCTTCCATATAAGGCTT[C/T]
ATACGGGGCCATTCGTATACTAGATTGATAACTATTGTTATATGCAAATTCTGCTAATGGCATAAATTCTTCCCATGATCCTTTAAATTCTAGGATGCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.20% 23.50% 0.11% 2.20% NA
All Indica  2759 82.80% 17.10% 0.07% 0.00% NA
All Japonica  1512 53.40% 39.60% 0.20% 6.75% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 83.90% 16.10% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 73.50% 26.40% 0.11% 0.00% NA
Indica Intermediate  786 84.40% 15.50% 0.13% 0.00% NA
Temperate Japonica  767 77.70% 8.90% 0.26% 13.17% NA
Tropical Japonica  504 12.30% 87.70% 0.00% 0.00% NA
Japonica Intermediate  241 62.20% 36.90% 0.41% 0.41% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 75.60% 22.20% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010925312 G -> A LOC_Os10g21350.1 missense_variant ; p.Glu1012Lys; MODERATE nonsynonymous_codon ; E1012K Average:36.566; most accessible tissue: Callus, score: 55.309 benign 0.521 DELETERIOUS 0.00
vg1010925312 G -> DEL LOC_Os10g21350.1 N frameshift_variant Average:36.566; most accessible tissue: Callus, score: 55.309 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010925312 NA 5.73E-08 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010925312 NA 7.96E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010925312 NA 7.11E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010925312 NA 3.24E-08 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010925312 NA 2.71E-07 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010925312 NA 2.68E-11 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010925312 NA 1.51E-08 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010925312 NA 2.59E-08 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010925312 3.98E-06 NA mr1959 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010925312 NA 2.61E-09 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010925312 NA 5.78E-06 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010925312 NA 3.65E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010925312 NA 6.55E-08 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010925312 NA 2.27E-07 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010925312 NA 2.20E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010925312 NA 2.28E-07 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010925312 NA 2.35E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251