Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1010888144:

Variant ID: vg1010888144 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 10888144
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.71, A: 0.29, others allele: 0.00, population size: 31. )

Flanking Sequence (100 bp) in Reference Genome:

GAGTGGCATTCGATGTCCAACATCTCGATCGAAGTATGGAGGTCAGAATAAATAGAATAATGATGAATGGAAAAAAAAGAAAATCCTTTAGCTGGATAAG[A/G]
GGCGGATGTAGCCAAGTGGATCAAGGCAGTGGATTGTGAATCCACCATGCGCGGGTTCAATTCCCGTTGTTCGCCCATCCCATTATTGCAAATTCCAAAA

Reverse complement sequence

TTTTGGAATTTGCAATAATGGGATGGGCGAACAACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGATCCACTTGGCTACATCCGCC[T/C]
CTTATCCAGCTAAAGGATTTTCTTTTTTTTCCATTCATCATTATTCTATTTATTCTGACCTCCATACTTCGATCGAGATGTTGGACATCGAATGCCACTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	17.20%	4.60%	38.38%	39.80%	NA
All Indica	2759	2.20%	4.20%	28.49%	65.10%	NA
All Japonica	1512	47.80%	5.20%	43.78%	3.24%	NA
Aus	269	1.10%	4.50%	90.33%	4.09%	NA
Indica I	595	4.70%	6.60%	19.16%	69.58%	NA
Indica II	465	2.40%	4.50%	13.55%	79.57%	NA
Indica III	913	1.10%	1.20%	39.43%	58.27%	NA
Indica Intermediate	786	1.50%	5.70%	31.68%	61.07%	NA
Temperate Japonica	767	72.60%	3.90%	21.90%	1.56%	NA
Tropical Japonica	504	9.50%	6.00%	79.96%	4.56%	NA
Japonica Intermediate	241	49.00%	7.50%	37.76%	5.81%	NA
VI/Aromatic	96	4.20%	6.20%	88.54%	1.04%	NA
Intermediate	90	24.40%	6.70%	42.22%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1010888144	A -> G	LOC_Os10g21342.1	upstream_gene_variant ; 3424.0bp to feature; MODIFIER	silent_mutation	Average:20.43; most accessible tissue: Minghui63 young leaf, score: 44.63	N	N	N	N
vg1010888144	A -> G	LOC_Os10g21344.1	upstream_gene_variant ; 2908.0bp to feature; MODIFIER	silent_mutation	Average:20.43; most accessible tissue: Minghui63 young leaf, score: 44.63	N	N	N	N
vg1010888144	A -> G	LOC_Os10g21346.1	upstream_gene_variant ; 935.0bp to feature; MODIFIER	silent_mutation	Average:20.43; most accessible tissue: Minghui63 young leaf, score: 44.63	N	N	N	N
vg1010888144	A -> G	LOC_Os10g21352.1	upstream_gene_variant ; 7.0bp to feature; MODIFIER	silent_mutation	Average:20.43; most accessible tissue: Minghui63 young leaf, score: 44.63	N	N	N	N
vg1010888144	A -> G	LOC_Os10g21356.1	upstream_gene_variant ; 237.0bp to feature; MODIFIER	silent_mutation	Average:20.43; most accessible tissue: Minghui63 young leaf, score: 44.63	N	N	N	N
vg1010888144	A -> G	LOC_Os10g21366.1	upstream_gene_variant ; 2947.0bp to feature; MODIFIER	silent_mutation	Average:20.43; most accessible tissue: Minghui63 young leaf, score: 44.63	N	N	N	N
vg1010888144	A -> G	LOC_Os10g21358.1	downstream_gene_variant ; 1634.0bp to feature; MODIFIER	silent_mutation	Average:20.43; most accessible tissue: Minghui63 young leaf, score: 44.63	N	N	N	N
vg1010888144	A -> G	LOC_Os10g21352-LOC_Os10g21356	intergenic_region ; MODIFIER	silent_mutation	Average:20.43; most accessible tissue: Minghui63 young leaf, score: 44.63	N	N	N	N
vg1010888144	A -> DEL	N	N	silent_mutation	Average:20.43; most accessible tissue: Minghui63 young leaf, score: 44.63	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1010888144	NA	7.91E-06	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010888144	NA	4.30E-06	mr1647_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010888144	2.99E-06	2.99E-06	mr1647_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010888144	NA	4.05E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251