\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010606791:

Variant ID: vg1010606791 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10606791
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


GGATACTTGTATTCAGAACCCCATTCTGGTTTGTTTCAGTTTCATCACTTGACAAGTGACGTGAGTTGTTTCCTTGTCAACTTGTTCTTGCTAGTTCTTC[G/T]
ATTGCTTGCAGGTTCAAGGTTGTTCTTGGCACGGTAAGAACAGCAACAACGTGGAGTCAGTGTACCGGTTGCTAAGGCGCAGCACCTCTGTGGTAGTTGT

Reverse complement sequence

ACAACTACCACAGAGGTGCTGCGCCTTAGCAACCGGTACACTGACTCCACGTTGTTGCTGTTCTTACCGTGCCAAGAACAACCTTGAACCTGCAAGCAAT[C/A]
GAAGAACTAGCAAGAACAAGTTGACAAGGAAACAACTCACGTCACTTGTCAAGTGATGAAACTGAAACAAACCAGAATGGGGTTCTGAATACAAGTATCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.70% 3.40% 20.88% 47.97% NA
All Indica  2759 5.00% 5.90% 24.21% 64.95% NA
All Japonica  1512 71.30% 0.00% 10.32% 18.39% NA
Aus  269 19.30% 0.00% 37.92% 42.75% NA
Indica I  595 4.20% 10.10% 10.76% 74.96% NA
Indica II  465 4.70% 5.20% 16.99% 73.12% NA
Indica III  913 5.00% 4.70% 34.39% 55.86% NA
Indica Intermediate  786 5.60% 4.50% 26.84% 63.10% NA
Temperate Japonica  767 90.20% 0.00% 5.35% 4.43% NA
Tropical Japonica  504 50.00% 0.00% 13.69% 36.31% NA
Japonica Intermediate  241 55.60% 0.00% 19.09% 25.31% NA
VI/Aromatic  96 11.50% 0.00% 37.50% 51.04% NA
Intermediate  90 35.60% 0.00% 27.78% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010606791 G -> T LOC_Os10g20940.1 upstream_gene_variant ; 3165.0bp to feature; MODIFIER silent_mutation Average:23.043; most accessible tissue: Callus, score: 48.441 N N N N
vg1010606791 G -> T LOC_Os10g20950.1 downstream_gene_variant ; 2004.0bp to feature; MODIFIER silent_mutation Average:23.043; most accessible tissue: Callus, score: 48.441 N N N N
vg1010606791 G -> T LOC_Os10g20960.1 intron_variant ; MODIFIER silent_mutation Average:23.043; most accessible tissue: Callus, score: 48.441 N N N N
vg1010606791 G -> DEL N N silent_mutation Average:23.043; most accessible tissue: Callus, score: 48.441 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010606791 NA 3.64E-48 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791 NA 8.74E-16 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791 1.85E-06 3.82E-13 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791 NA 5.78E-47 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791 NA 5.28E-15 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791 NA 3.88E-08 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791 NA 1.80E-08 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791 NA 1.13E-19 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791 NA 2.66E-08 mr1261 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791 NA 6.19E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791 NA 2.49E-16 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791 NA 4.83E-15 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791 NA 8.11E-17 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791 NA 3.29E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791 NA 6.57E-54 mr1108_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791 NA 2.56E-11 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791 3.63E-06 5.77E-08 mr1120_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791 NA 1.18E-41 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791 NA 4.04E-12 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791 NA 6.47E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791 1.31E-06 3.56E-07 mr1247_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791 NA 8.11E-19 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791 NA 1.73E-09 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791 NA 3.90E-14 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251