Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010606791:

Variant ID: vg1010606791 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 10606791
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:

GGATACTTGTATTCAGAACCCCATTCTGGTTTGTTTCAGTTTCATCACTTGACAAGTGACGTGAGTTGTTTCCTTGTCAACTTGTTCTTGCTAGTTCTTC[G/T]
ATTGCTTGCAGGTTCAAGGTTGTTCTTGGCACGGTAAGAACAGCAACAACGTGGAGTCAGTGTACCGGTTGCTAAGGCGCAGCACCTCTGTGGTAGTTGT

Reverse complement sequence

ACAACTACCACAGAGGTGCTGCGCCTTAGCAACCGGTACACTGACTCCACGTTGTTGCTGTTCTTACCGTGCCAAGAACAACCTTGAACCTGCAAGCAAT[C/A]
GAAGAACTAGCAAGAACAAGTTGACAAGGAAACAACTCACGTCACTTGTCAAGTGATGAAACTGAAACAAACCAGAATGGGGTTCTGAATACAAGTATCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.70%	3.40%	20.88%	47.97%	NA
All Indica	2759	5.00%	5.90%	24.21%	64.95%	NA
All Japonica	1512	71.30%	0.00%	10.32%	18.39%	NA
Aus	269	19.30%	0.00%	37.92%	42.75%	NA
Indica I	595	4.20%	10.10%	10.76%	74.96%	NA
Indica II	465	4.70%	5.20%	16.99%	73.12%	NA
Indica III	913	5.00%	4.70%	34.39%	55.86%	NA
Indica Intermediate	786	5.60%	4.50%	26.84%	63.10%	NA
Temperate Japonica	767	90.20%	0.00%	5.35%	4.43%	NA
Tropical Japonica	504	50.00%	0.00%	13.69%	36.31%	NA
Japonica Intermediate	241	55.60%	0.00%	19.09%	25.31%	NA
VI/Aromatic	96	11.50%	0.00%	37.50%	51.04%	NA
Intermediate	90	35.60%	0.00%	27.78%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1010606791	G -> T	LOC_Os10g20940.1	upstream_gene_variant ; 3165.0bp to feature; MODIFIER	silent_mutation	Average:23.043; most accessible tissue: Callus, score: 48.441	N	N	N	N
vg1010606791	G -> T	LOC_Os10g20950.1	downstream_gene_variant ; 2004.0bp to feature; MODIFIER	silent_mutation	Average:23.043; most accessible tissue: Callus, score: 48.441	N	N	N	N
vg1010606791	G -> T	LOC_Os10g20960.1	intron_variant ; MODIFIER	silent_mutation	Average:23.043; most accessible tissue: Callus, score: 48.441	N	N	N	N
vg1010606791	G -> DEL	N	N	silent_mutation	Average:23.043; most accessible tissue: Callus, score: 48.441	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1010606791	NA	3.64E-48	mr1026	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791	NA	8.74E-16	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791	1.85E-06	3.82E-13	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791	NA	5.78E-47	mr1161	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791	NA	5.28E-15	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791	NA	3.88E-08	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791	NA	1.80E-08	mr1260	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791	NA	1.13E-19	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791	NA	2.66E-08	mr1261	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791	NA	6.19E-09	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791	NA	2.49E-16	mr1531	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791	NA	4.83E-15	mr1583	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791	NA	8.11E-17	mr1807	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791	NA	3.29E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791	NA	6.57E-54	mr1108_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791	NA	2.56E-11	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791	3.63E-06	5.77E-08	mr1120_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791	NA	1.18E-41	mr1161_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791	NA	4.04E-12	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791	NA	6.47E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791	1.31E-06	3.56E-07	mr1247_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791	NA	8.11E-19	mr1531_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791	NA	1.73E-09	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010606791	NA	3.90E-14	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251