\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010596386:

Variant ID: vg1010596386 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10596386
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCTACCTCGCTTGGCAACATTGCTTCCGCACCATAGACCAGAAAAAACGGTGACTGACCCGTGGCCCGACTGGGCGTAGTATGCAGAGACCAAAGTACG[G/A]
ATGGCAGCTGATCTACCCATTTGCCAGCATAGGGATGCAGTCGGTCGAAAACTCACGCTTTGATTCCTTGAAGTACCATACCATTGGCACGTTCGACTTA

Reverse complement sequence

TAAGTCGAACGTGCCAATGGTATGGTACTTCAAGGAATCAAAGCGTGAGTTTTCGACCGACTGCATCCCTATGCTGGCAAATGGGTAGATCAGCTGCCAT[C/T]
CGTACTTTGGTCTCTGCATACTACGCCCAGTCGGGCCACGGGTCAGTCACCGTTTTTTCTGGTCTATGGTGCGGAAGCAATGTTGCCAAGCGAGGTAGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.50% 0.70% 1.29% 6.47% NA
All Indica  2759 97.40% 1.20% 1.27% 0.14% NA
All Japonica  1512 79.40% 0.00% 1.32% 19.31% NA
Aus  269 97.40% 0.40% 1.12% 1.12% NA
Indica I  595 94.30% 4.40% 1.34% 0.00% NA
Indica II  465 99.40% 0.00% 0.65% 0.00% NA
Indica III  913 98.10% 0.00% 1.64% 0.22% NA
Indica Intermediate  786 97.70% 0.90% 1.15% 0.25% NA
Temperate Japonica  767 96.00% 0.00% 0.26% 3.78% NA
Tropical Japonica  504 56.00% 0.00% 3.37% 40.67% NA
Japonica Intermediate  241 75.50% 0.00% 0.41% 24.07% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 92.20% 0.00% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010596386 G -> A LOC_Os10g20910.1 upstream_gene_variant ; 4976.0bp to feature; MODIFIER silent_mutation Average:30.561; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg1010596386 G -> A LOC_Os10g20920.1 downstream_gene_variant ; 827.0bp to feature; MODIFIER silent_mutation Average:30.561; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg1010596386 G -> A LOC_Os10g20930.1 downstream_gene_variant ; 98.0bp to feature; MODIFIER silent_mutation Average:30.561; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg1010596386 G -> A LOC_Os10g20920-LOC_Os10g20930 intergenic_region ; MODIFIER silent_mutation Average:30.561; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg1010596386 G -> DEL N N silent_mutation Average:30.561; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010596386 2.35E-06 1.08E-07 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010596386 NA 7.52E-07 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010596386 4.02E-08 6.23E-09 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010596386 4.80E-06 2.41E-06 mr1437 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010596386 2.79E-06 9.46E-10 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010596386 1.32E-06 9.27E-10 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010596386 9.65E-06 1.83E-08 mr1147_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010596386 NA 2.30E-08 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010596386 1.65E-06 1.65E-06 mr1250_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010596386 NA 1.04E-07 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251