\
| Variant ID: vg1010596386 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 10596386 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTCTACCTCGCTTGGCAACATTGCTTCCGCACCATAGACCAGAAAAAACGGTGACTGACCCGTGGCCCGACTGGGCGTAGTATGCAGAGACCAAAGTACG[G/A]
ATGGCAGCTGATCTACCCATTTGCCAGCATAGGGATGCAGTCGGTCGAAAACTCACGCTTTGATTCCTTGAAGTACCATACCATTGGCACGTTCGACTTA
TAAGTCGAACGTGCCAATGGTATGGTACTTCAAGGAATCAAAGCGTGAGTTTTCGACCGACTGCATCCCTATGCTGGCAAATGGGTAGATCAGCTGCCAT[C/T]
CGTACTTTGGTCTCTGCATACTACGCCCAGTCGGGCCACGGGTCAGTCACCGTTTTTTCTGGTCTATGGTGCGGAAGCAATGTTGCCAAGCGAGGTAGAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.50% | 0.70% | 1.29% | 6.47% | NA |
| All Indica | 2759 | 97.40% | 1.20% | 1.27% | 0.14% | NA |
| All Japonica | 1512 | 79.40% | 0.00% | 1.32% | 19.31% | NA |
| Aus | 269 | 97.40% | 0.40% | 1.12% | 1.12% | NA |
| Indica I | 595 | 94.30% | 4.40% | 1.34% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.00% | 0.65% | 0.00% | NA |
| Indica III | 913 | 98.10% | 0.00% | 1.64% | 0.22% | NA |
| Indica Intermediate | 786 | 97.70% | 0.90% | 1.15% | 0.25% | NA |
| Temperate Japonica | 767 | 96.00% | 0.00% | 0.26% | 3.78% | NA |
| Tropical Japonica | 504 | 56.00% | 0.00% | 3.37% | 40.67% | NA |
| Japonica Intermediate | 241 | 75.50% | 0.00% | 0.41% | 24.07% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 92.20% | 0.00% | 3.33% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1010596386 | G -> A | LOC_Os10g20910.1 | upstream_gene_variant ; 4976.0bp to feature; MODIFIER | silent_mutation | Average:30.561; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg1010596386 | G -> A | LOC_Os10g20920.1 | downstream_gene_variant ; 827.0bp to feature; MODIFIER | silent_mutation | Average:30.561; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg1010596386 | G -> A | LOC_Os10g20930.1 | downstream_gene_variant ; 98.0bp to feature; MODIFIER | silent_mutation | Average:30.561; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg1010596386 | G -> A | LOC_Os10g20920-LOC_Os10g20930 | intergenic_region ; MODIFIER | silent_mutation | Average:30.561; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg1010596386 | G -> DEL | N | N | silent_mutation | Average:30.561; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1010596386 | 2.35E-06 | 1.08E-07 | mr1053 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010596386 | NA | 7.52E-07 | mr1070 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010596386 | 4.02E-08 | 6.23E-09 | mr1128 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010596386 | 4.80E-06 | 2.41E-06 | mr1437 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010596386 | 2.79E-06 | 9.46E-10 | mr1053_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010596386 | 1.32E-06 | 9.27E-10 | mr1128_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010596386 | 9.65E-06 | 1.83E-08 | mr1147_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010596386 | NA | 2.30E-08 | mr1204_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010596386 | 1.65E-06 | 1.65E-06 | mr1250_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010596386 | NA | 1.04E-07 | mr1264_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |