Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1010596386:

Variant ID: vg1010596386 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 10596386
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCTACCTCGCTTGGCAACATTGCTTCCGCACCATAGACCAGAAAAAACGGTGACTGACCCGTGGCCCGACTGGGCGTAGTATGCAGAGACCAAAGTACG[G/A]
ATGGCAGCTGATCTACCCATTTGCCAGCATAGGGATGCAGTCGGTCGAAAACTCACGCTTTGATTCCTTGAAGTACCATACCATTGGCACGTTCGACTTA

Reverse complement sequence

TAAGTCGAACGTGCCAATGGTATGGTACTTCAAGGAATCAAAGCGTGAGTTTTCGACCGACTGCATCCCTATGCTGGCAAATGGGTAGATCAGCTGCCAT[C/T]
CGTACTTTGGTCTCTGCATACTACGCCCAGTCGGGCCACGGGTCAGTCACCGTTTTTTCTGGTCTATGGTGCGGAAGCAATGTTGCCAAGCGAGGTAGAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.50%	0.70%	1.29%	6.47%	NA
All Indica	2759	97.40%	1.20%	1.27%	0.14%	NA
All Japonica	1512	79.40%	0.00%	1.32%	19.31%	NA
Aus	269	97.40%	0.40%	1.12%	1.12%	NA
Indica I	595	94.30%	4.40%	1.34%	0.00%	NA
Indica II	465	99.40%	0.00%	0.65%	0.00%	NA
Indica III	913	98.10%	0.00%	1.64%	0.22%	NA
Indica Intermediate	786	97.70%	0.90%	1.15%	0.25%	NA
Temperate Japonica	767	96.00%	0.00%	0.26%	3.78%	NA
Tropical Japonica	504	56.00%	0.00%	3.37%	40.67%	NA
Japonica Intermediate	241	75.50%	0.00%	0.41%	24.07%	NA
VI/Aromatic	96	96.90%	0.00%	0.00%	3.12%	NA
Intermediate	90	92.20%	0.00%	3.33%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1010596386	G -> A	LOC_Os10g20910.1	upstream_gene_variant ; 4976.0bp to feature; MODIFIER	silent_mutation	Average:30.561; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg1010596386	G -> A	LOC_Os10g20920.1	downstream_gene_variant ; 827.0bp to feature; MODIFIER	silent_mutation	Average:30.561; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg1010596386	G -> A	LOC_Os10g20930.1	downstream_gene_variant ; 98.0bp to feature; MODIFIER	silent_mutation	Average:30.561; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg1010596386	G -> A	LOC_Os10g20920-LOC_Os10g20930	intergenic_region ; MODIFIER	silent_mutation	Average:30.561; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg1010596386	G -> DEL	N	N	silent_mutation	Average:30.561; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1010596386	2.35E-06	1.08E-07	mr1053	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010596386	NA	7.52E-07	mr1070	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010596386	4.02E-08	6.23E-09	mr1128	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010596386	4.80E-06	2.41E-06	mr1437	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010596386	2.79E-06	9.46E-10	mr1053_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010596386	1.32E-06	9.27E-10	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010596386	9.65E-06	1.83E-08	mr1147_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010596386	NA	2.30E-08	mr1204_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010596386	1.65E-06	1.65E-06	mr1250_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010596386	NA	1.04E-07	mr1264_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251