\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010595641:

Variant ID: vg1010595641 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10595641
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTGGTCAACAAAATTAAGAAGCTTGAAGGAGCCAGGGATGAAGTTGCCAACGCCGCTACACCACTCATCCAAGCCATGTTTTTTTAATAATAATGGTC[T/C]
GAGTTCGTTCGACGCTATTGAAACTTCGACAAGCTGAGAGCTGCTTCGGATACATACTTTAAGAACATCAAAGAAGCTGGATGCATGGGGGCGAGCATGG

Reverse complement sequence

CCATGCTCGCCCCCATGCATCCAGCTTCTTTGATGTTCTTAAAGTATGTATCCGAAGCAGCTCTCAGCTTGTCGAAGTTTCAATAGCGTCGAACGAACTC[A/G]
GACCATTATTATTAAAAAAACATGGCTTGGATGAGTGGTGTAGCGGCGTTGGCAACTTCATCCCTGGCTCCTTCAAGCTTCTTAATTTTGTTGACCAAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.00% 21.60% 1.54% 6.79% NA
All Indica  2759 97.40% 1.10% 1.38% 0.07% NA
All Japonica  1512 14.40% 63.60% 1.92% 20.04% NA
Aus  269 97.80% 0.00% 0.00% 2.23% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 94.50% 2.00% 3.50% 0.00% NA
Indica Intermediate  786 98.10% 0.90% 0.76% 0.25% NA
Temperate Japonica  767 15.50% 80.30% 0.00% 4.17% NA
Tropical Japonica  504 5.80% 47.00% 5.16% 42.06% NA
Japonica Intermediate  241 29.00% 45.20% 1.24% 24.48% NA
VI/Aromatic  96 89.60% 3.10% 3.12% 4.17% NA
Intermediate  90 61.10% 28.90% 3.33% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010595641 T -> C LOC_Os10g20910.1 upstream_gene_variant ; 4231.0bp to feature; MODIFIER silent_mutation Average:28.679; most accessible tissue: Minghui63 young leaf, score: 40.718 N N N N
vg1010595641 T -> C LOC_Os10g20920.1 downstream_gene_variant ; 82.0bp to feature; MODIFIER silent_mutation Average:28.679; most accessible tissue: Minghui63 young leaf, score: 40.718 N N N N
vg1010595641 T -> C LOC_Os10g20930.1 downstream_gene_variant ; 843.0bp to feature; MODIFIER silent_mutation Average:28.679; most accessible tissue: Minghui63 young leaf, score: 40.718 N N N N
vg1010595641 T -> C LOC_Os10g20920-LOC_Os10g20930 intergenic_region ; MODIFIER silent_mutation Average:28.679; most accessible tissue: Minghui63 young leaf, score: 40.718 N N N N
vg1010595641 T -> DEL N N silent_mutation Average:28.679; most accessible tissue: Minghui63 young leaf, score: 40.718 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010595641 NA 2.84E-08 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010595641 NA 6.29E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010595641 NA 1.04E-19 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010595641 NA 1.65E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010595641 1.23E-06 1.75E-11 mr1660_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010595641 6.93E-06 1.94E-06 mr1660_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010595641 NA 5.14E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010595641 NA 3.98E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251