\
| Variant ID: vg1010595641 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 10595641 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 236. )
TCTTGGTCAACAAAATTAAGAAGCTTGAAGGAGCCAGGGATGAAGTTGCCAACGCCGCTACACCACTCATCCAAGCCATGTTTTTTTAATAATAATGGTC[T/C]
GAGTTCGTTCGACGCTATTGAAACTTCGACAAGCTGAGAGCTGCTTCGGATACATACTTTAAGAACATCAAAGAAGCTGGATGCATGGGGGCGAGCATGG
CCATGCTCGCCCCCATGCATCCAGCTTCTTTGATGTTCTTAAAGTATGTATCCGAAGCAGCTCTCAGCTTGTCGAAGTTTCAATAGCGTCGAACGAACTC[A/G]
GACCATTATTATTAAAAAAACATGGCTTGGATGAGTGGTGTAGCGGCGTTGGCAACTTCATCCCTGGCTCCTTCAAGCTTCTTAATTTTGTTGACCAAGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.00% | 21.60% | 1.54% | 6.79% | NA |
| All Indica | 2759 | 97.40% | 1.10% | 1.38% | 0.07% | NA |
| All Japonica | 1512 | 14.40% | 63.60% | 1.92% | 20.04% | NA |
| Aus | 269 | 97.80% | 0.00% | 0.00% | 2.23% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.50% | 2.00% | 3.50% | 0.00% | NA |
| Indica Intermediate | 786 | 98.10% | 0.90% | 0.76% | 0.25% | NA |
| Temperate Japonica | 767 | 15.50% | 80.30% | 0.00% | 4.17% | NA |
| Tropical Japonica | 504 | 5.80% | 47.00% | 5.16% | 42.06% | NA |
| Japonica Intermediate | 241 | 29.00% | 45.20% | 1.24% | 24.48% | NA |
| VI/Aromatic | 96 | 89.60% | 3.10% | 3.12% | 4.17% | NA |
| Intermediate | 90 | 61.10% | 28.90% | 3.33% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1010595641 | T -> C | LOC_Os10g20910.1 | upstream_gene_variant ; 4231.0bp to feature; MODIFIER | silent_mutation | Average:28.679; most accessible tissue: Minghui63 young leaf, score: 40.718 | N | N | N | N |
| vg1010595641 | T -> C | LOC_Os10g20920.1 | downstream_gene_variant ; 82.0bp to feature; MODIFIER | silent_mutation | Average:28.679; most accessible tissue: Minghui63 young leaf, score: 40.718 | N | N | N | N |
| vg1010595641 | T -> C | LOC_Os10g20930.1 | downstream_gene_variant ; 843.0bp to feature; MODIFIER | silent_mutation | Average:28.679; most accessible tissue: Minghui63 young leaf, score: 40.718 | N | N | N | N |
| vg1010595641 | T -> C | LOC_Os10g20920-LOC_Os10g20930 | intergenic_region ; MODIFIER | silent_mutation | Average:28.679; most accessible tissue: Minghui63 young leaf, score: 40.718 | N | N | N | N |
| vg1010595641 | T -> DEL | N | N | silent_mutation | Average:28.679; most accessible tissue: Minghui63 young leaf, score: 40.718 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1010595641 | NA | 2.84E-08 | mr1806 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010595641 | NA | 6.29E-06 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010595641 | NA | 1.04E-19 | mr1168_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010595641 | NA | 1.65E-08 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010595641 | 1.23E-06 | 1.75E-11 | mr1660_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010595641 | 6.93E-06 | 1.94E-06 | mr1660_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010595641 | NA | 5.14E-08 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010595641 | NA | 3.98E-10 | mr1806_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |