\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010594417:

Variant ID: vg1010594417 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10594417
Reference Allele: TAlternative Allele: C,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCCAAACATACACCATCGAAGTAGTGTTAATAGCATATCTCAAATCTGCAGGAAGCCATCTGACATCGATCCTTCTAGGAAAGACTAAACCGACTAGCA[T/C,A]
GGAGACTGGTCCTACGACCTCCACAGAAACCGGGCCGACCGCCGAAAATCGCCTGACTAGTAGTCAACCAGCGACCGATAATATAGAGGCCAGCAATGAG

Reverse complement sequence

CTCATTGCTGGCCTCTATATTATCGGTCGCTGGTTGACTACTAGTCAGGCGATTTTCGGCGGTCGGCCCGGTTTCTGTGGAGGTCGTAGGACCAGTCTCC[A/G,T]
TGCTAGTCGGTTTAGTCTTTCCTAGAAGGATCGATGTCAGATGGCTTCCTGCAGATTTGAGATATGCTATTAACACTACTTCGATGGTGTATGTTTGGCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.30% 21.10% 1.54% 9.04% A: 0.04%
All Indica  2759 94.10% 0.80% 1.81% 3.26% A: 0.07%
All Japonica  1512 15.30% 62.60% 0.93% 21.16% NA
Aus  269 97.00% 0.70% 0.00% 2.23% NA
Indica I  595 99.70% 0.20% 0.00% 0.17% NA
Indica II  465 91.00% 0.90% 0.86% 7.31% NA
Indica III  913 92.30% 1.00% 4.05% 2.41% A: 0.22%
Indica Intermediate  786 93.80% 0.90% 1.15% 4.20% NA
Temperate Japonica  767 15.40% 79.50% 0.52% 4.56% NA
Tropical Japonica  504 8.10% 46.20% 1.98% 43.65% NA
Japonica Intermediate  241 29.90% 43.20% 0.00% 26.97% NA
VI/Aromatic  96 89.60% 2.10% 5.21% 3.12% NA
Intermediate  90 57.80% 28.90% 4.44% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010594417 T -> C LOC_Os10g20910.1 upstream_gene_variant ; 3007.0bp to feature; MODIFIER silent_mutation Average:49.213; most accessible tissue: Zhenshan97 young leaf, score: 81.841 N N N N
vg1010594417 T -> C LOC_Os10g20900.1 downstream_gene_variant ; 4910.0bp to feature; MODIFIER silent_mutation Average:49.213; most accessible tissue: Zhenshan97 young leaf, score: 81.841 N N N N
vg1010594417 T -> C LOC_Os10g20930.1 downstream_gene_variant ; 2067.0bp to feature; MODIFIER silent_mutation Average:49.213; most accessible tissue: Zhenshan97 young leaf, score: 81.841 N N N N
vg1010594417 T -> C LOC_Os10g20920.1 intron_variant ; MODIFIER silent_mutation Average:49.213; most accessible tissue: Zhenshan97 young leaf, score: 81.841 N N N N
vg1010594417 T -> A LOC_Os10g20910.1 upstream_gene_variant ; 3007.0bp to feature; MODIFIER silent_mutation Average:49.213; most accessible tissue: Zhenshan97 young leaf, score: 81.841 N N N N
vg1010594417 T -> A LOC_Os10g20900.1 downstream_gene_variant ; 4910.0bp to feature; MODIFIER silent_mutation Average:49.213; most accessible tissue: Zhenshan97 young leaf, score: 81.841 N N N N
vg1010594417 T -> A LOC_Os10g20930.1 downstream_gene_variant ; 2067.0bp to feature; MODIFIER silent_mutation Average:49.213; most accessible tissue: Zhenshan97 young leaf, score: 81.841 N N N N
vg1010594417 T -> A LOC_Os10g20920.1 intron_variant ; MODIFIER silent_mutation Average:49.213; most accessible tissue: Zhenshan97 young leaf, score: 81.841 N N N N
vg1010594417 T -> DEL N N silent_mutation Average:49.213; most accessible tissue: Zhenshan97 young leaf, score: 81.841 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010594417 NA 1.98E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010594417 NA 9.60E-10 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010594417 9.84E-06 1.75E-10 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010594417 7.04E-07 4.28E-07 mr1660_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251