Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1010576786:

Variant ID: vg1010576786 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 10576786
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGCAACCGCGCCAGTCACCGCCTCAAGGACAAGCATGACAAGCATGGTGGAAGGCGACTCACCACCATGGCAATGGCACTAAGATCCATTGCTTGCAAGT[T/C]
CTTTTTCACCCAAGTACTTTTGCATGTAGTTCACTTGCTGCTTCATGTAGTTCATGTTGTTCACATTGTTGCCGCAGTGATGATTCCAATCCCTGTGGTT

Reverse complement sequence

AACCACAGGGATTGGAATCATCACTGCGGCAACAATGTGAACAACATGAACTACATGAAGCAGCAAGTGAACTACATGCAAAAGTACTTGGGTGAAAAAG[A/G]
ACTTGCAAGCAATGGATCTTAGTGCCATTGCCATGGTGGTGAGTCGCCTTCCACCATGCTTGTCATGCTTGTCCTTGAGGCGGTGACTGGCGCGGTTGCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.70%	22.20%	0.76%	26.32%	NA
All Indica	2759	78.10%	1.10%	0.47%	20.26%	NA
All Japonica	1512	12.90%	64.20%	0.73%	22.16%	NA
Aus	269	1.50%	1.50%	3.72%	93.31%	NA
Indica I	595	96.30%	0.20%	0.00%	3.53%	NA
Indica II	465	88.40%	1.10%	0.43%	10.11%	NA
Indica III	913	64.40%	1.60%	0.33%	33.63%	NA
Indica Intermediate	786	74.30%	1.30%	1.02%	23.41%	NA
Temperate Japonica	767	14.90%	80.80%	0.39%	3.91%	NA
Tropical Japonica	504	3.80%	47.80%	0.99%	47.42%	NA
Japonica Intermediate	241	25.70%	45.60%	1.24%	27.39%	NA
VI/Aromatic	96	6.20%	14.60%	2.08%	77.08%	NA
Intermediate	90	38.90%	33.30%	0.00%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1010576786	T -> C	LOC_Os10g20860.1	upstream_gene_variant ; 2797.0bp to feature; MODIFIER	silent_mutation	Average:47.277; most accessible tissue: Zhenshan97 young leaf, score: 78.347	N	N	N	N
vg1010576786	T -> C	LOC_Os10g20870.1	upstream_gene_variant ; 1246.0bp to feature; MODIFIER	silent_mutation	Average:47.277; most accessible tissue: Zhenshan97 young leaf, score: 78.347	N	N	N	N
vg1010576786	T -> C	LOC_Os10g20880.1	downstream_gene_variant ; 1024.0bp to feature; MODIFIER	silent_mutation	Average:47.277; most accessible tissue: Zhenshan97 young leaf, score: 78.347	N	N	N	N
vg1010576786	T -> C	LOC_Os10g20870-LOC_Os10g20880	intergenic_region ; MODIFIER	silent_mutation	Average:47.277; most accessible tissue: Zhenshan97 young leaf, score: 78.347	N	N	N	N
vg1010576786	T -> DEL	N	N	silent_mutation	Average:47.277; most accessible tissue: Zhenshan97 young leaf, score: 78.347	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1010576786	NA	1.16E-06	mr1111	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010576786	5.99E-06	NA	mr1112	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010576786	NA	1.95E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010576786	NA	2.36E-06	mr1517	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010576786	NA	5.69E-06	mr1536	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010576786	4.95E-07	NA	mr1718	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010576786	9.39E-06	1.58E-06	mr1768	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010576786	NA	1.05E-09	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010576786	NA	1.85E-08	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251