\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010576786:

Variant ID: vg1010576786 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10576786
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCAACCGCGCCAGTCACCGCCTCAAGGACAAGCATGACAAGCATGGTGGAAGGCGACTCACCACCATGGCAATGGCACTAAGATCCATTGCTTGCAAGT[T/C]
CTTTTTCACCCAAGTACTTTTGCATGTAGTTCACTTGCTGCTTCATGTAGTTCATGTTGTTCACATTGTTGCCGCAGTGATGATTCCAATCCCTGTGGTT

Reverse complement sequence

AACCACAGGGATTGGAATCATCACTGCGGCAACAATGTGAACAACATGAACTACATGAAGCAGCAAGTGAACTACATGCAAAAGTACTTGGGTGAAAAAG[A/G]
ACTTGCAAGCAATGGATCTTAGTGCCATTGCCATGGTGGTGAGTCGCCTTCCACCATGCTTGTCATGCTTGTCCTTGAGGCGGTGACTGGCGCGGTTGCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.70% 22.20% 0.76% 26.32% NA
All Indica  2759 78.10% 1.10% 0.47% 20.26% NA
All Japonica  1512 12.90% 64.20% 0.73% 22.16% NA
Aus  269 1.50% 1.50% 3.72% 93.31% NA
Indica I  595 96.30% 0.20% 0.00% 3.53% NA
Indica II  465 88.40% 1.10% 0.43% 10.11% NA
Indica III  913 64.40% 1.60% 0.33% 33.63% NA
Indica Intermediate  786 74.30% 1.30% 1.02% 23.41% NA
Temperate Japonica  767 14.90% 80.80% 0.39% 3.91% NA
Tropical Japonica  504 3.80% 47.80% 0.99% 47.42% NA
Japonica Intermediate  241 25.70% 45.60% 1.24% 27.39% NA
VI/Aromatic  96 6.20% 14.60% 2.08% 77.08% NA
Intermediate  90 38.90% 33.30% 0.00% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010576786 T -> C LOC_Os10g20860.1 upstream_gene_variant ; 2797.0bp to feature; MODIFIER silent_mutation Average:47.277; most accessible tissue: Zhenshan97 young leaf, score: 78.347 N N N N
vg1010576786 T -> C LOC_Os10g20870.1 upstream_gene_variant ; 1246.0bp to feature; MODIFIER silent_mutation Average:47.277; most accessible tissue: Zhenshan97 young leaf, score: 78.347 N N N N
vg1010576786 T -> C LOC_Os10g20880.1 downstream_gene_variant ; 1024.0bp to feature; MODIFIER silent_mutation Average:47.277; most accessible tissue: Zhenshan97 young leaf, score: 78.347 N N N N
vg1010576786 T -> C LOC_Os10g20870-LOC_Os10g20880 intergenic_region ; MODIFIER silent_mutation Average:47.277; most accessible tissue: Zhenshan97 young leaf, score: 78.347 N N N N
vg1010576786 T -> DEL N N silent_mutation Average:47.277; most accessible tissue: Zhenshan97 young leaf, score: 78.347 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010576786 NA 1.16E-06 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010576786 5.99E-06 NA mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010576786 NA 1.95E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010576786 NA 2.36E-06 mr1517 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010576786 NA 5.69E-06 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010576786 4.95E-07 NA mr1718 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010576786 9.39E-06 1.58E-06 mr1768 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010576786 NA 1.05E-09 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010576786 NA 1.85E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251