\
| Variant ID: vg1010572055 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 10572055 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CAAATGTTAGTCTTCTTGGGAACAACCATGTGTATTGTGTTCTATAGCATAGCTAAGGTGGTGTTTGGATTCAGGGACTTAACTTTAGTCCCTATATTTA[A/G]
ACACTAATTTAGAGTATTAAATATAGACTACTTACAAAATTAATTACATAAATAAAAGCTAATTTGCGAGATAAATTTTTTAAGCCTAATTAATCTATAA
TTATAGATTAATTAGGCTTAAAAAATTTATCTCGCAAATTAGCTTTTATTTATGTAATTAATTTTGTAAGTAGTCTATATTTAATACTCTAAATTAGTGT[T/C]
TAAATATAGGGACTAAAGTTAAGTCCCTGAATCCAAACACCACCTTAGCTATGCTATAGAACACAATACACATGGTTGTTCCCAAGAAGACTAACATTTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 17.90% | 6.50% | 2.94% | 72.68% | NA |
| All Indica | 2759 | 1.70% | 0.30% | 3.33% | 94.71% | NA |
| All Japonica | 1512 | 49.90% | 19.00% | 2.12% | 28.97% | NA |
| Aus | 269 | 1.10% | 0.00% | 2.60% | 96.28% | NA |
| Indica I | 595 | 1.00% | 0.20% | 3.70% | 95.13% | NA |
| Indica II | 465 | 1.70% | 0.20% | 4.52% | 93.55% | NA |
| Indica III | 913 | 1.50% | 0.40% | 1.97% | 96.06% | NA |
| Indica Intermediate | 786 | 2.40% | 0.10% | 3.94% | 93.51% | NA |
| Temperate Japonica | 767 | 61.30% | 28.80% | 3.26% | 6.65% | NA |
| Tropical Japonica | 504 | 43.70% | 4.40% | 0.20% | 51.79% | NA |
| Japonica Intermediate | 241 | 27.00% | 18.30% | 2.49% | 52.28% | NA |
| VI/Aromatic | 96 | 12.50% | 5.20% | 3.12% | 79.17% | NA |
| Intermediate | 90 | 33.30% | 6.70% | 5.56% | 54.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1010572055 | A -> G | LOC_Os10g20870.1 | downstream_gene_variant ; 2945.0bp to feature; MODIFIER | silent_mutation | Average:43.884; most accessible tissue: Callus, score: 95.98 | N | N | N | N |
| vg1010572055 | A -> G | LOC_Os10g20860.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.884; most accessible tissue: Callus, score: 95.98 | N | N | N | N |
| vg1010572055 | A -> DEL | N | N | silent_mutation | Average:43.884; most accessible tissue: Callus, score: 95.98 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1010572055 | NA | 2.24E-06 | mr1041_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010572055 | NA | 2.39E-06 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010572055 | NA | 3.94E-06 | mr1278_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010572055 | NA | 1.69E-06 | mr1293_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010572055 | 2.94E-06 | 2.94E-06 | mr1371_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010572055 | 4.65E-06 | NA | mr1417_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010572055 | 5.94E-06 | 4.42E-06 | mr1417_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010572055 | NA | 7.47E-06 | mr1508_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010572055 | 8.88E-06 | 2.79E-06 | mr1556_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010572055 | 4.04E-06 | NA | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010572055 | 6.00E-07 | NA | mr1647_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010572055 | 2.96E-06 | 2.96E-06 | mr1647_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010572055 | 7.43E-06 | NA | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010572055 | 9.44E-06 | 9.44E-06 | mr1648_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010572055 | 8.64E-06 | NA | mr1672_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010572055 | 2.46E-06 | NA | mr1840_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010572055 | 9.05E-06 | 1.09E-07 | mr1992_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |