\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010570787:

Variant ID: vg1010570787 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10570787
Reference Allele: AAlternative Allele: C,T
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, T: 0.12, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


AATATATATAATGGATTTTAGAAAGAAAAAACGACTTACAACAATCAAATTAAAGTGATTCAAGGATGATAAAACCGCACATCAATCTGCAAACCCGACA[A/C,T]
GAGACTTACTCACGGGGAACAATAGCCAACAACCACAATAGCGAACAACCACACCAAATTAAACTCTGGAATATTATAACTGTGCCGCTTAGCAGGTGAA

Reverse complement sequence

TTCACCTGCTAAGCGGCACAGTTATAATATTCCAGAGTTTAATTTGGTGTGGTTGTTCGCTATTGTGGTTGTTGGCTATTGTTCCCCGTGAGTAAGTCTC[T/G,A]
TGTCGGGTTTGCAGATTGATGTGCGGTTTTATCATCCTTGAATCACTTTAATTTGATTGTTGTAAGTCGTTTTTTCTTTCTAAAATCCATTATATATATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.50% 42.60% 1.69% 0.21% T: 0.02%
All Indica  2759 25.30% 71.50% 2.83% 0.33% NA
All Japonica  1512 99.10% 0.80% 0.13% 0.00% NA
Aus  269 99.30% 0.40% 0.00% 0.00% T: 0.37%
Indica I  595 8.10% 87.20% 4.54% 0.17% NA
Indica II  465 14.40% 81.10% 3.66% 0.86% NA
Indica III  913 37.80% 60.90% 0.88% 0.44% NA
Indica Intermediate  786 30.40% 66.30% 3.31% 0.00% NA
Temperate Japonica  767 99.10% 0.80% 0.13% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 1.70% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 73.30% 25.60% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010570787 A -> C LOC_Os10g20840.1 upstream_gene_variant ; 3860.0bp to feature; MODIFIER silent_mutation Average:63.8; most accessible tissue: Callus, score: 75.923 N N N N
vg1010570787 A -> C LOC_Os10g20860.1 downstream_gene_variant ; 89.0bp to feature; MODIFIER silent_mutation Average:63.8; most accessible tissue: Callus, score: 75.923 N N N N
vg1010570787 A -> C LOC_Os10g20870.1 downstream_gene_variant ; 4213.0bp to feature; MODIFIER silent_mutation Average:63.8; most accessible tissue: Callus, score: 75.923 N N N N
vg1010570787 A -> C LOC_Os10g20840-LOC_Os10g20860 intergenic_region ; MODIFIER silent_mutation Average:63.8; most accessible tissue: Callus, score: 75.923 N N N N
vg1010570787 A -> T LOC_Os10g20840.1 upstream_gene_variant ; 3860.0bp to feature; MODIFIER silent_mutation Average:63.8; most accessible tissue: Callus, score: 75.923 N N N N
vg1010570787 A -> T LOC_Os10g20860.1 downstream_gene_variant ; 89.0bp to feature; MODIFIER silent_mutation Average:63.8; most accessible tissue: Callus, score: 75.923 N N N N
vg1010570787 A -> T LOC_Os10g20870.1 downstream_gene_variant ; 4213.0bp to feature; MODIFIER silent_mutation Average:63.8; most accessible tissue: Callus, score: 75.923 N N N N
vg1010570787 A -> T LOC_Os10g20840-LOC_Os10g20860 intergenic_region ; MODIFIER silent_mutation Average:63.8; most accessible tissue: Callus, score: 75.923 N N N N
vg1010570787 A -> DEL N N silent_mutation Average:63.8; most accessible tissue: Callus, score: 75.923 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010570787 3.44E-07 4.32E-51 mr1026 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 4.39E-07 3.70E-18 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 NA 6.38E-37 mr1091 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 NA 3.70E-44 mr1108 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 1.58E-06 4.49E-14 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 3.47E-07 3.26E-50 mr1161 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 2.79E-07 1.14E-17 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 NA 7.61E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 NA 4.22E-29 mr1221 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 NA 8.86E-09 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 NA 3.81E-20 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 4.41E-06 1.80E-09 mr1261 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 NA 3.08E-06 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 NA 2.57E-14 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 NA 1.50E-15 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 NA 1.05E-10 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 NA 4.84E-14 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 NA 7.56E-18 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 NA 2.77E-50 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 NA 1.81E-54 mr1108_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 NA 5.10E-15 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 NA 2.52E-18 mr1131_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 NA 1.05E-45 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 NA 2.80E-14 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 NA 2.38E-08 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 NA 8.70E-57 mr1234_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 NA 9.58E-07 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 NA 1.41E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010570787 NA 2.14E-19 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251