| Variant ID: vg1010568067 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 10568067 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AACAGCATGTTACCATGGGACTTTTTAAAGTTACATATACTTGCATTATATTTAAATGCAAGATACACTATATATAATGTTATATGATTATATTATATTT[G/A]
TACCTGTCAAATTATTGACAGAAAATTTATCAACAAATGTGTATAAACAGCCCCAATATGCTGAGACAATATGATTTATATGTCCACAATATAATGTGCT
AGCACATTATATTGTGGACATATAAATCATATTGTCTCAGCATATTGGGGCTGTTTATACACATTTGTTGATAAATTTTCTGTCAATAATTTGACAGGTA[C/T]
AAATATAATATAATCATATAACATTATATATAGTGTATCTTGCATTTAAATATAATGCAAGTATATGTAACTTTAAAAAGTCCCATGGTAACATGCTGTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.60% | 3.60% | 13.31% | 26.45% | NA |
| All Indica | 2759 | 33.70% | 0.10% | 21.46% | 44.73% | NA |
| All Japonica | 1512 | 86.80% | 11.00% | 1.92% | 0.20% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 10.10% | 0.20% | 35.46% | 54.29% | NA |
| Indica II | 465 | 22.80% | 0.40% | 23.01% | 53.76% | NA |
| Indica III | 913 | 52.70% | 0.00% | 11.94% | 35.38% | NA |
| Indica Intermediate | 786 | 36.00% | 0.00% | 20.99% | 43.00% | NA |
| Temperate Japonica | 767 | 76.80% | 21.00% | 2.09% | 0.13% | NA |
| Tropical Japonica | 504 | 98.00% | 0.40% | 1.59% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.40% | 1.70% | 2.07% | 0.83% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 78.90% | 1.10% | 8.89% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1010568067 | G -> A | LOC_Os10g20830.1 | upstream_gene_variant ; 4226.0bp to feature; MODIFIER | silent_mutation | Average:49.152; most accessible tissue: Minghui63 young leaf, score: 65.92 | N | N | N | N |
| vg1010568067 | G -> A | LOC_Os10g20840.1 | upstream_gene_variant ; 1140.0bp to feature; MODIFIER | silent_mutation | Average:49.152; most accessible tissue: Minghui63 young leaf, score: 65.92 | N | N | N | N |
| vg1010568067 | G -> A | LOC_Os10g20860.1 | downstream_gene_variant ; 2809.0bp to feature; MODIFIER | silent_mutation | Average:49.152; most accessible tissue: Minghui63 young leaf, score: 65.92 | N | N | N | N |
| vg1010568067 | G -> A | LOC_Os10g20840-LOC_Os10g20860 | intergenic_region ; MODIFIER | silent_mutation | Average:49.152; most accessible tissue: Minghui63 young leaf, score: 65.92 | N | N | N | N |
| vg1010568067 | G -> DEL | N | N | silent_mutation | Average:49.152; most accessible tissue: Minghui63 young leaf, score: 65.92 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1010568067 | NA | 3.64E-08 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1010568067 | NA | 4.02E-13 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1010568067 | NA | 5.43E-09 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010568067 | NA | 4.73E-10 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010568067 | NA | 2.58E-10 | mr1156_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010568067 | 5.90E-06 | 5.90E-06 | mr1172_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010568067 | NA | 5.96E-07 | mr1263_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010568067 | NA | 1.55E-06 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010568067 | NA | 3.80E-07 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010568067 | NA | 1.99E-07 | mr1624_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010568067 | NA | 8.82E-06 | mr1723_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010568067 | NA | 6.21E-07 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |