\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010568067:

Variant ID: vg1010568067 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10568067
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACAGCATGTTACCATGGGACTTTTTAAAGTTACATATACTTGCATTATATTTAAATGCAAGATACACTATATATAATGTTATATGATTATATTATATTT[G/A]
TACCTGTCAAATTATTGACAGAAAATTTATCAACAAATGTGTATAAACAGCCCCAATATGCTGAGACAATATGATTTATATGTCCACAATATAATGTGCT

Reverse complement sequence

AGCACATTATATTGTGGACATATAAATCATATTGTCTCAGCATATTGGGGCTGTTTATACACATTTGTTGATAAATTTTCTGTCAATAATTTGACAGGTA[C/T]
AAATATAATATAATCATATAACATTATATATAGTGTATCTTGCATTTAAATATAATGCAAGTATATGTAACTTTAAAAAGTCCCATGGTAACATGCTGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.60% 3.60% 13.31% 26.45% NA
All Indica  2759 33.70% 0.10% 21.46% 44.73% NA
All Japonica  1512 86.80% 11.00% 1.92% 0.20% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 10.10% 0.20% 35.46% 54.29% NA
Indica II  465 22.80% 0.40% 23.01% 53.76% NA
Indica III  913 52.70% 0.00% 11.94% 35.38% NA
Indica Intermediate  786 36.00% 0.00% 20.99% 43.00% NA
Temperate Japonica  767 76.80% 21.00% 2.09% 0.13% NA
Tropical Japonica  504 98.00% 0.40% 1.59% 0.00% NA
Japonica Intermediate  241 95.40% 1.70% 2.07% 0.83% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 78.90% 1.10% 8.89% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010568067 G -> A LOC_Os10g20830.1 upstream_gene_variant ; 4226.0bp to feature; MODIFIER silent_mutation Average:49.152; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N
vg1010568067 G -> A LOC_Os10g20840.1 upstream_gene_variant ; 1140.0bp to feature; MODIFIER silent_mutation Average:49.152; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N
vg1010568067 G -> A LOC_Os10g20860.1 downstream_gene_variant ; 2809.0bp to feature; MODIFIER silent_mutation Average:49.152; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N
vg1010568067 G -> A LOC_Os10g20840-LOC_Os10g20860 intergenic_region ; MODIFIER silent_mutation Average:49.152; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N
vg1010568067 G -> DEL N N silent_mutation Average:49.152; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010568067 NA 3.64E-08 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1010568067 NA 4.02E-13 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1010568067 NA 5.43E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010568067 NA 4.73E-10 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010568067 NA 2.58E-10 mr1156_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010568067 5.90E-06 5.90E-06 mr1172_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010568067 NA 5.96E-07 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010568067 NA 1.55E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010568067 NA 3.80E-07 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010568067 NA 1.99E-07 mr1624_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010568067 NA 8.82E-06 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010568067 NA 6.21E-07 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251