\
| Variant ID: vg1010567320 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr10 | Position: 10567320 |
| Reference Allele: C | Alternative Allele: T,CTTATTT,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGATATCATAATTTCTGGATCTATCAATATAATATTGTTTTTTCAGAGTTTCTTGGGTCTCGGATGTTATTCTCTGTTACTTATACTTGCACACTACGGG[C/T,CTTATTT,A]
CTGTTTGGCACAGCTCCAGCTCTAGCTCCACCCCTCCTAGAGCTGGAGCTCAGCCAAACAGTTTCAGCTCCACCAAAATTGGGAGTGAAGCTGAGTGGAG
CTCCACTCAGCTTCACTCCCAATTTTGGTGGAGCTGAAACTGTTTGGCTGAGCTCCAGCTCTAGGAGGGGTGGAGCTAGAGCTGGAGCTGTGCCAAACAG[G/A,AAATAAG,T]
CCCGTAGTGTGCAAGTATAAGTAACAGAGAATAACATCCGAGACCCAAGAAACTCTGAAAAAACAATATTATATTGATAGATCCAGAAATTATGATATCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.40% | 22.50% | 3.26% | 40.01% | CTTATTT: 0.99%; A: 0.89% |
| All Indica | 2759 | 18.30% | 5.90% | 5.29% | 67.31% | CTTATTT: 1.67%; A: 1.52% |
| All Japonica | 1512 | 64.30% | 34.70% | 0.20% | 0.86% | NA |
| Aus | 269 | 0.40% | 98.90% | 0.00% | 0.37% | CTTATTT: 0.37% |
| Indica I | 595 | 2.70% | 3.00% | 8.40% | 83.53% | CTTATTT: 1.85%; A: 0.50% |
| Indica II | 465 | 13.50% | 1.30% | 5.38% | 75.48% | CTTATTT: 2.15%; A: 2.15% |
| Indica III | 913 | 30.00% | 7.80% | 3.29% | 55.31% | A: 1.86%; CTTATTT: 1.75% |
| Indica Intermediate | 786 | 19.50% | 8.50% | 5.22% | 64.12% | A: 1.53%; CTTATTT: 1.15% |
| Temperate Japonica | 767 | 80.70% | 18.30% | 0.13% | 0.91% | NA |
| Tropical Japonica | 504 | 48.00% | 51.60% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 46.10% | 51.50% | 0.83% | 1.66% | NA |
| VI/Aromatic | 96 | 13.50% | 83.30% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 42.20% | 33.30% | 5.56% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1010567320 | C -> CTTATTT | LOC_Os10g20830.1 | upstream_gene_variant ; 3480.0bp to feature; MODIFIER | silent_mutation | Average:41.865; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg1010567320 | C -> CTTATTT | LOC_Os10g20840.1 | upstream_gene_variant ; 394.0bp to feature; MODIFIER | silent_mutation | Average:41.865; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg1010567320 | C -> CTTATTT | LOC_Os10g20860.1 | downstream_gene_variant ; 3555.0bp to feature; MODIFIER | silent_mutation | Average:41.865; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg1010567320 | C -> CTTATTT | LOC_Os10g20840-LOC_Os10g20860 | intergenic_region ; MODIFIER | silent_mutation | Average:41.865; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg1010567320 | C -> T | LOC_Os10g20830.1 | upstream_gene_variant ; 3479.0bp to feature; MODIFIER | silent_mutation | Average:41.865; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg1010567320 | C -> T | LOC_Os10g20840.1 | upstream_gene_variant ; 393.0bp to feature; MODIFIER | silent_mutation | Average:41.865; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg1010567320 | C -> T | LOC_Os10g20860.1 | downstream_gene_variant ; 3556.0bp to feature; MODIFIER | silent_mutation | Average:41.865; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg1010567320 | C -> T | LOC_Os10g20840-LOC_Os10g20860 | intergenic_region ; MODIFIER | silent_mutation | Average:41.865; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg1010567320 | C -> A | LOC_Os10g20830.1 | upstream_gene_variant ; 3479.0bp to feature; MODIFIER | silent_mutation | Average:41.865; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg1010567320 | C -> A | LOC_Os10g20840.1 | upstream_gene_variant ; 393.0bp to feature; MODIFIER | silent_mutation | Average:41.865; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg1010567320 | C -> A | LOC_Os10g20860.1 | downstream_gene_variant ; 3556.0bp to feature; MODIFIER | silent_mutation | Average:41.865; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg1010567320 | C -> A | LOC_Os10g20840-LOC_Os10g20860 | intergenic_region ; MODIFIER | silent_mutation | Average:41.865; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg1010567320 | C -> DEL | N | N | silent_mutation | Average:41.865; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1010567320 | NA | 8.52E-18 | Plant_height | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1010567320 | NA | 7.63E-07 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010567320 | NA | 3.91E-12 | mr1409 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010567320 | NA | 5.91E-07 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010567320 | NA | 1.37E-13 | mr1409_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010567320 | NA | 1.14E-07 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010567320 | 1.61E-06 | NA | mr1660_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010567320 | 1.38E-06 | 2.50E-07 | mr1660_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |