\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010157820:

Variant ID: vg1010157820 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10157820
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTATGGTTGCGGACAGAGGCTCCGTCCCAGAATATAGCAACCTAAGACCCTTCTGTCCAGATTCGTAGTAGTAGGATATGTCCCATCCGGTTATAGGTT[G/T,A]
CTATATTCTAGGACGGAGGGAGTACTTTGTACCATATGCGAAGTCTAGTTCATCAATGGATTCCTATTCTATACTCCCTCCGTCCCTGATATAAGAGCAT

Reverse complement sequence

ATGCTCTTATATCAGGGACGGAGGGAGTATAGAATAGGAATCCATTGATGAACTAGACTTCGCATATGGTACAAAGTACTCCCTCCGTCCTAGAATATAG[C/A,T]
AACCTATAACCGGATGGGACATATCCTACTACTACGAATCTGGACAGAAGGGTCTTAGGTTGCTATATTCTGGGACGGAGCCTCTGTCCGCAACCATAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.90% 2.60% 0.02% 0.00% T: 1.46%
All Indica  2759 99.50% 0.00% 0.00% 0.00% T: 0.51%
All Japonica  1512 91.70% 8.10% 0.07% 0.00% T: 0.13%
Aus  269 99.30% 0.00% 0.00% 0.00% T: 0.74%
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 98.90% 0.00% 0.00% 0.00% T: 1.10%
Indica Intermediate  786 99.50% 0.00% 0.00% 0.00% T: 0.51%
Temperate Japonica  767 85.90% 14.10% 0.00% 0.00% NA
Tropical Japonica  504 97.20% 2.40% 0.20% 0.00% T: 0.20%
Japonica Intermediate  241 98.30% 1.20% 0.00% 0.00% T: 0.41%
VI/Aromatic  96 52.10% 0.00% 0.00% 0.00% T: 47.92%
Intermediate  90 94.40% 0.00% 0.00% 0.00% T: 5.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010157820 G -> T LOC_Os10g20220.1 upstream_gene_variant ; 4639.0bp to feature; MODIFIER silent_mutation Average:68.249; most accessible tissue: Zhenshan97 flag leaf, score: 81.008 N N N N
vg1010157820 G -> T LOC_Os10g20220-LOC_Os10g20230 intergenic_region ; MODIFIER silent_mutation Average:68.249; most accessible tissue: Zhenshan97 flag leaf, score: 81.008 N N N N
vg1010157820 G -> A LOC_Os10g20220.1 upstream_gene_variant ; 4639.0bp to feature; MODIFIER silent_mutation Average:68.249; most accessible tissue: Zhenshan97 flag leaf, score: 81.008 N N N N
vg1010157820 G -> A LOC_Os10g20220-LOC_Os10g20230 intergenic_region ; MODIFIER silent_mutation Average:68.249; most accessible tissue: Zhenshan97 flag leaf, score: 81.008 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010157820 NA 4.13E-07 mr1006 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010157820 NA 3.18E-06 mr1007 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010157820 NA 1.08E-06 mr1052 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010157820 NA 6.47E-09 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010157820 6.19E-06 2.13E-09 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010157820 1.74E-06 1.74E-06 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010157820 NA 1.91E-07 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010157820 NA 1.93E-08 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010157820 NA 3.89E-08 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010157820 NA 1.37E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010157820 NA 3.07E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010157820 4.14E-06 4.14E-06 mr1992 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010157820 4.04E-07 7.94E-10 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010157820 NA 1.31E-06 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010157820 NA 9.39E-06 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010157820 1.22E-07 6.75E-13 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251