\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010118163:

Variant ID: vg1010118163 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10118163
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, A: 0.22, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


AACCTCCGAAAATTTTTATATGGTTAGCCCATTTGTGATTTTGTTTTAATACATGCAATCTTTCGATCCAATGGCCATTATTTATCTGAACTCTTTATCT[G/A]
ACGGCTAATATATTTTTGATGATGTGGCGCATCCTGGTACCAGAAAGCTTGTTGCTTCTGACGGCTAATATATTTTTGATGATGTGGCACATCCTCGTAC

Reverse complement sequence

GTACGAGGATGTGCCACATCATCAAAAATATATTAGCCGTCAGAAGCAACAAGCTTTCTGGTACCAGGATGCGCCACATCATCAAAAATATATTAGCCGT[C/T]
AGATAAAGAGTTCAGATAAATAATGGCCATTGGATCGAAAGATTGCATGTATTAAAACAAAATCACAAATGGGCTAACCATATAAAAATTTTCGGAGGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.50% 29.00% 0.28% 1.21% NA
All Indica  2759 64.90% 32.70% 0.36% 1.99% NA
All Japonica  1512 87.60% 12.40% 0.07% 0.00% NA
Aus  269 19.70% 80.30% 0.00% 0.00% NA
Indica I  595 26.10% 70.10% 0.84% 3.03% NA
Indica II  465 82.20% 15.70% 0.22% 1.94% NA
Indica III  913 79.50% 18.90% 0.11% 1.42% NA
Indica Intermediate  786 67.20% 30.50% 0.38% 1.91% NA
Temperate Japonica  767 79.00% 20.90% 0.13% 0.00% NA
Tropical Japonica  504 95.80% 4.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 47.90% 51.00% 1.04% 0.00% NA
Intermediate  90 77.80% 18.90% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010118163 G -> A LOC_Os10g20160.1 downstream_gene_variant ; 1800.0bp to feature; MODIFIER silent_mutation Average:75.353; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg1010118163 G -> A LOC_Os10g20139-LOC_Os10g20160 intergenic_region ; MODIFIER silent_mutation Average:75.353; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg1010118163 G -> DEL N N silent_mutation Average:75.353; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1010118163 G A -0.1 -0.06 -0.07 -0.08 -0.09 -0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010118163 NA 3.48E-13 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010118163 2.36E-06 NA mr1070 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010118163 NA 1.22E-12 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010118163 NA 7.04E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010118163 NA 5.14E-12 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010118163 NA 3.52E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010118163 NA 2.60E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010118163 NA 3.16E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010118163 NA 7.44E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010118163 NA 7.57E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010118163 NA 6.02E-15 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010118163 NA 9.34E-07 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010118163 NA 2.87E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010118163 NA 1.83E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010118163 NA 3.19E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010118163 NA 6.07E-06 mr1802 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010118163 NA 9.03E-15 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010118163 NA 8.08E-07 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010118163 NA 5.99E-16 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010118163 NA 8.35E-07 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010118163 NA 7.39E-16 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010118163 NA 5.46E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010118163 NA 1.81E-08 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251