Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1010068253:

Variant ID: vg1010068253 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 10068253
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

TAGGCAAGTTTGTTACAGAAAGCGGAGCGGAAGAAGTCAGACAAGAAGAGAAGACCGCCCAACCTATCTTCATGCTAGCCTCCTCGAATCTCGGGGACGA[A/G]
ATTCTTGTAAGGGGGGTGGATTTGTCACGTCCTGATAAATTCATCCCGAAATAAAAATCATTCTCTAAAAGGAATAATAGAATTAATTAAAATTCGAAAA

Reverse complement sequence

TTTTCGAATTTTAATTAATTCTATTATTCCTTTTAGAGAATGATTTTTATTTCGGGATGAATTTATCAGGACGTGACAAATCCACCCCCCTTACAAGAAT[T/C]
TCGTCCCCGAGATTCGAGGAGGCTAGCATGAAGATAGGTTGGGCGGTCTTCTCTTCTTGTCTGACTTCTTCCGCTCCGCTTTCTGTAACAAACTTGCCTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	14.50%	5.40%	18.22%	61.91%	NA
All Indica	2759	2.00%	8.30%	22.25%	67.49%	NA
All Japonica	1512	39.90%	0.10%	6.48%	53.51%	NA
Aus	269	0.70%	1.50%	32.34%	65.43%	NA
Indica I	595	3.40%	2.40%	12.44%	81.85%	NA
Indica II	465	1.70%	8.80%	18.06%	71.40%	NA
Indica III	913	1.40%	12.30%	28.92%	57.39%	NA
Indica Intermediate	786	1.70%	7.90%	24.43%	66.03%	NA
Temperate Japonica	767	57.40%	0.10%	1.56%	40.94%	NA
Tropical Japonica	504	8.50%	0.00%	16.27%	75.20%	NA
Japonica Intermediate	241	49.80%	0.40%	1.66%	48.13%	NA
VI/Aromatic	96	1.00%	14.60%	46.88%	37.50%	NA
Intermediate	90	25.60%	7.80%	18.89%	47.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1010068253	A -> G	LOC_Os10g20060.1	upstream_gene_variant ; 4969.0bp to feature; MODIFIER	silent_mutation	Average:12.966; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg1010068253	A -> G	LOC_Os10g20050.1	downstream_gene_variant ; 1855.0bp to feature; MODIFIER	silent_mutation	Average:12.966; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg1010068253	A -> G	LOC_Os10g20050-LOC_Os10g20060	intergenic_region ; MODIFIER	silent_mutation	Average:12.966; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg1010068253	A -> DEL	N	N	silent_mutation	Average:12.966; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1010068253	3.98E-06	3.99E-06	mr1061	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010068253	7.32E-06	7.31E-06	mr1061	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010068253	NA	3.34E-07	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010068253	NA	2.42E-07	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010068253	NA	8.88E-06	mr1292	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010068253	NA	6.61E-08	mr1446	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010068253	NA	7.81E-06	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010068253	NA	2.36E-07	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010068253	5.23E-06	1.56E-20	mr1768	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010068253	NA	7.79E-06	mr1768	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010068253	NA	2.31E-08	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010068253	NA	5.37E-29	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010068253	NA	1.19E-06	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251