\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1010068253:

Variant ID: vg1010068253 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 10068253
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


TAGGCAAGTTTGTTACAGAAAGCGGAGCGGAAGAAGTCAGACAAGAAGAGAAGACCGCCCAACCTATCTTCATGCTAGCCTCCTCGAATCTCGGGGACGA[A/G]
ATTCTTGTAAGGGGGGTGGATTTGTCACGTCCTGATAAATTCATCCCGAAATAAAAATCATTCTCTAAAAGGAATAATAGAATTAATTAAAATTCGAAAA

Reverse complement sequence

TTTTCGAATTTTAATTAATTCTATTATTCCTTTTAGAGAATGATTTTTATTTCGGGATGAATTTATCAGGACGTGACAAATCCACCCCCCTTACAAGAAT[T/C]
TCGTCCCCGAGATTCGAGGAGGCTAGCATGAAGATAGGTTGGGCGGTCTTCTCTTCTTGTCTGACTTCTTCCGCTCCGCTTTCTGTAACAAACTTGCCTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 14.50% 5.40% 18.22% 61.91% NA
All Indica  2759 2.00% 8.30% 22.25% 67.49% NA
All Japonica  1512 39.90% 0.10% 6.48% 53.51% NA
Aus  269 0.70% 1.50% 32.34% 65.43% NA
Indica I  595 3.40% 2.40% 12.44% 81.85% NA
Indica II  465 1.70% 8.80% 18.06% 71.40% NA
Indica III  913 1.40% 12.30% 28.92% 57.39% NA
Indica Intermediate  786 1.70% 7.90% 24.43% 66.03% NA
Temperate Japonica  767 57.40% 0.10% 1.56% 40.94% NA
Tropical Japonica  504 8.50% 0.00% 16.27% 75.20% NA
Japonica Intermediate  241 49.80% 0.40% 1.66% 48.13% NA
VI/Aromatic  96 1.00% 14.60% 46.88% 37.50% NA
Intermediate  90 25.60% 7.80% 18.89% 47.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1010068253 A -> G LOC_Os10g20060.1 upstream_gene_variant ; 4969.0bp to feature; MODIFIER silent_mutation Average:12.966; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg1010068253 A -> G LOC_Os10g20050.1 downstream_gene_variant ; 1855.0bp to feature; MODIFIER silent_mutation Average:12.966; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg1010068253 A -> G LOC_Os10g20050-LOC_Os10g20060 intergenic_region ; MODIFIER silent_mutation Average:12.966; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg1010068253 A -> DEL N N silent_mutation Average:12.966; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1010068253 3.98E-06 3.99E-06 mr1061 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010068253 7.32E-06 7.31E-06 mr1061 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010068253 NA 3.34E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010068253 NA 2.42E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010068253 NA 8.88E-06 mr1292 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010068253 NA 6.61E-08 mr1446 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010068253 NA 7.81E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010068253 NA 2.36E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010068253 5.23E-06 1.56E-20 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010068253 NA 7.79E-06 mr1768 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010068253 NA 2.31E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010068253 NA 5.37E-29 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1010068253 NA 1.19E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251