\
| Variant ID: vg1009691370 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9691370 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 291. )
ATATCTCAAATCCTTGGCATATCTCTTCTCAGCATCTGTTGGTCTCGTCTTGTTGTTCCTTGAGGCTGTTCCTTGGCCTCGCGCTCTCTGCCCTCTGCTT[C/T]
AGCTTCTTCCGTTGACATGAGGGCTAGAACGAGATGACTCTCAGAGATACACTCACGAAACTCTCCAACTCCAAGTCCAAGAGCTTGACGAACTTGTCAA
TTGACAAGTTCGTCAAGCTCTTGGACTTGGAGTTGGAGAGTTTCGTGAGTGTATCTCTGAGAGTCATCTCGTTCTAGCCCTCATGTCAACGGAAGAAGCT[G/A]
AAGCAGAGGGCAGAGAGCGCGAGGCCAAGGAACAGCCTCAAGGAACAACAAGACGAGACCAACAGATGCTGAGAAGAGATATGCCAAGGATTTGAGATAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.20% | 27.60% | 0.34% | 7.83% | NA |
| All Indica | 2759 | 60.90% | 38.60% | 0.04% | 0.43% | NA |
| All Japonica | 1512 | 63.40% | 12.30% | 0.93% | 23.35% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 75.00% | 25.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 41.90% | 57.80% | 0.00% | 0.22% | NA |
| Indica III | 913 | 65.10% | 33.70% | 0.00% | 1.20% | NA |
| Indica Intermediate | 786 | 56.60% | 43.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 75.60% | 1.00% | 0.65% | 22.69% | NA |
| Tropical Japonica | 504 | 35.70% | 31.20% | 1.79% | 31.35% | NA |
| Japonica Intermediate | 241 | 82.60% | 8.70% | 0.00% | 8.71% | NA |
| VI/Aromatic | 96 | 77.10% | 22.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 28.90% | 1.11% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009691370 | C -> T | LOC_Os10g19030.1 | synonymous_variant ; p.Phe82Phe; LOW | synonymous_codon | Average:63.589; most accessible tissue: Zhenshan97 young leaf, score: 84.814 | N | N | N | N |
| vg1009691370 | C -> DEL | LOC_Os10g19030.1 | N | frameshift_variant | Average:63.589; most accessible tissue: Zhenshan97 young leaf, score: 84.814 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009691370 | 2.03E-06 | 2.65E-10 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009691370 | 4.95E-07 | 4.87E-07 | mr1053 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009691370 | 4.62E-06 | NA | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009691370 | 2.46E-06 | NA | mr1070 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009691370 | 5.04E-07 | NA | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009691370 | 3.29E-07 | 5.18E-07 | mr1128 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009691370 | 8.16E-07 | NA | mr1147 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009691370 | 2.90E-06 | 4.35E-06 | mr1147 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009691370 | NA | 8.80E-13 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009691370 | NA | 7.09E-10 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009691370 | NA | 1.13E-08 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009691370 | NA | 8.50E-07 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009691370 | 7.45E-06 | 1.58E-06 | mr1053_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009691370 | NA | 5.84E-08 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009691370 | NA | 1.76E-09 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009691370 | NA | 1.49E-09 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |