\
| Variant ID: vg1009662675 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9662675 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.60, T: 0.40, others allele: 0.00, population size: 80. )
CCTGGAGCAATTTGGGATGGGTTACGGACATGTGAACGTAGTCTTACTCTGGTCCTCCGGATGGATGGGAATTTGATGATATCCGGAATATCCATCAAGG[A/T]
AACAGAAGAAGGAATGATTTGCCAGCCGTTCCAACATTTCATCAATGAAGGGTAGCGGGAAATGATCCTTTTTTTAAGCCTCGTTGAGTTTCTTGTAATC
GATTACAAGAAACTCAACGAGGCTTAAAAAAAGGATCATTTCCCGCTACCCTTCATTGATGAAATGTTGGAACGGCTGGCAAATCATTCCTTCTTCTGTT[T/A]
CCTTGATGGATATTCCGGATATCATCAAATTCCCATCCATCCGGAGGACCAGAGTAAGACTACGTTCACATGTCCGTAACCCATCCCAAATTGCTCCAGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.20% | 41.70% | 1.02% | 10.03% | NA |
| All Indica | 2759 | 27.10% | 55.70% | 1.49% | 15.62% | NA |
| All Japonica | 1512 | 73.70% | 23.40% | 0.33% | 2.51% | NA |
| Aus | 269 | 87.70% | 11.50% | 0.00% | 0.74% | NA |
| Indica I | 595 | 10.80% | 71.90% | 0.84% | 16.47% | NA |
| Indica II | 465 | 36.30% | 39.80% | 3.23% | 20.65% | NA |
| Indica III | 913 | 28.60% | 60.10% | 0.88% | 10.41% | NA |
| Indica Intermediate | 786 | 32.40% | 47.80% | 1.65% | 18.07% | NA |
| Temperate Japonica | 767 | 83.20% | 16.70% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 70.40% | 21.80% | 0.79% | 6.94% | NA |
| Japonica Intermediate | 241 | 50.60% | 48.10% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 80.20% | 19.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 33.30% | 2.22% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009662675 | A -> T | LOC_Os10g18970.1 | upstream_gene_variant ; 3601.0bp to feature; MODIFIER | silent_mutation | Average:28.841; most accessible tissue: Minghui63 young leaf, score: 47.146 | N | N | N | N |
| vg1009662675 | A -> T | LOC_Os10g18990.1 | upstream_gene_variant ; 4492.0bp to feature; MODIFIER | silent_mutation | Average:28.841; most accessible tissue: Minghui63 young leaf, score: 47.146 | N | N | N | N |
| vg1009662675 | A -> T | LOC_Os10g18980.1 | downstream_gene_variant ; 471.0bp to feature; MODIFIER | silent_mutation | Average:28.841; most accessible tissue: Minghui63 young leaf, score: 47.146 | N | N | N | N |
| vg1009662675 | A -> T | LOC_Os10g18970-LOC_Os10g18980 | intergenic_region ; MODIFIER | silent_mutation | Average:28.841; most accessible tissue: Minghui63 young leaf, score: 47.146 | N | N | N | N |
| vg1009662675 | A -> DEL | N | N | silent_mutation | Average:28.841; most accessible tissue: Minghui63 young leaf, score: 47.146 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009662675 | 4.61E-06 | 1.41E-06 | mr1053 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009662675 | 6.77E-08 | NA | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009662675 | NA | 5.15E-06 | mr1070 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009662675 | 6.96E-06 | NA | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009662675 | 7.12E-06 | 6.01E-07 | mr1128 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009662675 | 2.18E-06 | NA | mr1152 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009662675 | NA | 4.48E-09 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009662675 | NA | 2.54E-09 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009662675 | NA | 6.21E-06 | mr1792 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009662675 | NA | 5.89E-08 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009662675 | NA | 6.74E-06 | mr1691_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009662675 | NA | 1.07E-11 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009662675 | NA | 7.28E-09 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |