\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009662675:

Variant ID: vg1009662675 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9662675
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.60, T: 0.40, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


CCTGGAGCAATTTGGGATGGGTTACGGACATGTGAACGTAGTCTTACTCTGGTCCTCCGGATGGATGGGAATTTGATGATATCCGGAATATCCATCAAGG[A/T]
AACAGAAGAAGGAATGATTTGCCAGCCGTTCCAACATTTCATCAATGAAGGGTAGCGGGAAATGATCCTTTTTTTAAGCCTCGTTGAGTTTCTTGTAATC

Reverse complement sequence

GATTACAAGAAACTCAACGAGGCTTAAAAAAAGGATCATTTCCCGCTACCCTTCATTGATGAAATGTTGGAACGGCTGGCAAATCATTCCTTCTTCTGTT[T/A]
CCTTGATGGATATTCCGGATATCATCAAATTCCCATCCATCCGGAGGACCAGAGTAAGACTACGTTCACATGTCCGTAACCCATCCCAAATTGCTCCAGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.20% 41.70% 1.02% 10.03% NA
All Indica  2759 27.10% 55.70% 1.49% 15.62% NA
All Japonica  1512 73.70% 23.40% 0.33% 2.51% NA
Aus  269 87.70% 11.50% 0.00% 0.74% NA
Indica I  595 10.80% 71.90% 0.84% 16.47% NA
Indica II  465 36.30% 39.80% 3.23% 20.65% NA
Indica III  913 28.60% 60.10% 0.88% 10.41% NA
Indica Intermediate  786 32.40% 47.80% 1.65% 18.07% NA
Temperate Japonica  767 83.20% 16.70% 0.00% 0.13% NA
Tropical Japonica  504 70.40% 21.80% 0.79% 6.94% NA
Japonica Intermediate  241 50.60% 48.10% 0.41% 0.83% NA
VI/Aromatic  96 80.20% 19.80% 0.00% 0.00% NA
Intermediate  90 61.10% 33.30% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009662675 A -> T LOC_Os10g18970.1 upstream_gene_variant ; 3601.0bp to feature; MODIFIER silent_mutation Average:28.841; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N
vg1009662675 A -> T LOC_Os10g18990.1 upstream_gene_variant ; 4492.0bp to feature; MODIFIER silent_mutation Average:28.841; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N
vg1009662675 A -> T LOC_Os10g18980.1 downstream_gene_variant ; 471.0bp to feature; MODIFIER silent_mutation Average:28.841; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N
vg1009662675 A -> T LOC_Os10g18970-LOC_Os10g18980 intergenic_region ; MODIFIER silent_mutation Average:28.841; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N
vg1009662675 A -> DEL N N silent_mutation Average:28.841; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009662675 4.61E-06 1.41E-06 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009662675 6.77E-08 NA mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009662675 NA 5.15E-06 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009662675 6.96E-06 NA mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009662675 7.12E-06 6.01E-07 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009662675 2.18E-06 NA mr1152 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009662675 NA 4.48E-09 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009662675 NA 2.54E-09 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009662675 NA 6.21E-06 mr1792 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009662675 NA 5.89E-08 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009662675 NA 6.74E-06 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009662675 NA 1.07E-11 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009662675 NA 7.28E-09 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251