\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009652409:

Variant ID: vg1009652409 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9652409
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGCTTGACACAGGTATTTTCTTGAGACCATTTAAAACTCCAATTTAGGCTTGGGAAAGAACTTCGGGGTGTGACAGGTTGCCCCGTGCGAAGAGGTGTC[G/A]
ATGACGTCGAACGGTCCTTCCCATTTGCTGCGCAGTTTTCCGTGGCCGAAGGGCTTAACTCTGGAGTTGAACAACTGTAATTTGTCTCCTGGTTTGAATT

Reverse complement sequence

AATTCAAACCAGGAGACAAATTACAGTTGTTCAACTCCAGAGTTAAGCCCTTCGGCCACGGAAAACTGCGCAGCAAATGGGAAGGACCGTTCGACGTCAT[C/T]
GACACCTCTTCGCACGGGGCAACCTGTCACACCCCGAAGTTCTTTCCCAAGCCTAAATTGGAGTTTTAAATGGTCTCAAGAAAATACCTGTGTCAAGCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.90% 12.20% 3.22% 38.66% NA
All Indica  2759 37.80% 3.80% 3.55% 54.80% NA
All Japonica  1512 68.10% 10.00% 2.91% 19.05% NA
Aus  269 12.30% 85.50% 1.12% 1.12% NA
Indica I  595 70.90% 1.80% 1.85% 25.38% NA
Indica II  465 21.70% 1.30% 2.37% 74.62% NA
Indica III  913 28.10% 3.50% 5.26% 63.09% NA
Indica Intermediate  786 33.60% 7.10% 3.56% 55.73% NA
Temperate Japonica  767 85.30% 0.70% 0.65% 13.43% NA
Tropical Japonica  504 48.80% 25.60% 5.36% 20.24% NA
Japonica Intermediate  241 53.50% 7.10% 4.98% 34.44% NA
VI/Aromatic  96 19.80% 76.00% 2.08% 2.08% NA
Intermediate  90 50.00% 20.00% 5.56% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009652409 G -> A LOC_Os10g18940.1 upstream_gene_variant ; 4660.0bp to feature; MODIFIER silent_mutation Average:26.6; most accessible tissue: Minghui63 young leaf, score: 39.381 N N N N
vg1009652409 G -> A LOC_Os10g18960.1 downstream_gene_variant ; 438.0bp to feature; MODIFIER silent_mutation Average:26.6; most accessible tissue: Minghui63 young leaf, score: 39.381 N N N N
vg1009652409 G -> A LOC_Os10g18940-LOC_Os10g18960 intergenic_region ; MODIFIER silent_mutation Average:26.6; most accessible tissue: Minghui63 young leaf, score: 39.381 N N N N
vg1009652409 G -> DEL N N silent_mutation Average:26.6; most accessible tissue: Minghui63 young leaf, score: 39.381 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009652409 NA 2.33E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409 NA 4.03E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409 3.04E-06 3.04E-06 mr1260 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409 NA 7.27E-06 mr1346 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409 NA 2.68E-09 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409 NA 7.93E-07 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409 NA 4.85E-09 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409 NA 1.61E-06 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409 NA 5.67E-11 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409 NA 1.21E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409 NA 6.80E-09 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409 NA 1.58E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409 NA 7.30E-12 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409 NA 1.64E-07 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409 NA 2.76E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409 NA 7.96E-15 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251