Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009652409:

Variant ID: vg1009652409 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9652409
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGCTTGACACAGGTATTTTCTTGAGACCATTTAAAACTCCAATTTAGGCTTGGGAAAGAACTTCGGGGTGTGACAGGTTGCCCCGTGCGAAGAGGTGTC[G/A]
ATGACGTCGAACGGTCCTTCCCATTTGCTGCGCAGTTTTCCGTGGCCGAAGGGCTTAACTCTGGAGTTGAACAACTGTAATTTGTCTCCTGGTTTGAATT

Reverse complement sequence

AATTCAAACCAGGAGACAAATTACAGTTGTTCAACTCCAGAGTTAAGCCCTTCGGCCACGGAAAACTGCGCAGCAAATGGGAAGGACCGTTCGACGTCAT[C/T]
GACACCTCTTCGCACGGGGCAACCTGTCACACCCCGAAGTTCTTTCCCAAGCCTAAATTGGAGTTTTAAATGGTCTCAAGAAAATACCTGTGTCAAGCAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.90%	12.20%	3.22%	38.66%	NA
All Indica	2759	37.80%	3.80%	3.55%	54.80%	NA
All Japonica	1512	68.10%	10.00%	2.91%	19.05%	NA
Aus	269	12.30%	85.50%	1.12%	1.12%	NA
Indica I	595	70.90%	1.80%	1.85%	25.38%	NA
Indica II	465	21.70%	1.30%	2.37%	74.62%	NA
Indica III	913	28.10%	3.50%	5.26%	63.09%	NA
Indica Intermediate	786	33.60%	7.10%	3.56%	55.73%	NA
Temperate Japonica	767	85.30%	0.70%	0.65%	13.43%	NA
Tropical Japonica	504	48.80%	25.60%	5.36%	20.24%	NA
Japonica Intermediate	241	53.50%	7.10%	4.98%	34.44%	NA
VI/Aromatic	96	19.80%	76.00%	2.08%	2.08%	NA
Intermediate	90	50.00%	20.00%	5.56%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009652409	G -> A	LOC_Os10g18940.1	upstream_gene_variant ; 4660.0bp to feature; MODIFIER	silent_mutation	Average:26.6; most accessible tissue: Minghui63 young leaf, score: 39.381	N	N	N	N
vg1009652409	G -> A	LOC_Os10g18960.1	downstream_gene_variant ; 438.0bp to feature; MODIFIER	silent_mutation	Average:26.6; most accessible tissue: Minghui63 young leaf, score: 39.381	N	N	N	N
vg1009652409	G -> A	LOC_Os10g18940-LOC_Os10g18960	intergenic_region ; MODIFIER	silent_mutation	Average:26.6; most accessible tissue: Minghui63 young leaf, score: 39.381	N	N	N	N
vg1009652409	G -> DEL	N	N	silent_mutation	Average:26.6; most accessible tissue: Minghui63 young leaf, score: 39.381	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009652409	NA	2.33E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409	NA	4.03E-06	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409	3.04E-06	3.04E-06	mr1260	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409	NA	7.27E-06	mr1346	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409	NA	2.68E-09	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409	NA	7.93E-07	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409	NA	4.85E-09	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409	NA	1.61E-06	mr1808	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409	NA	5.67E-11	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409	NA	1.21E-06	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409	NA	6.80E-09	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409	NA	1.58E-07	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409	NA	7.30E-12	mr1803_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409	NA	1.64E-07	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409	NA	2.76E-06	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009652409	NA	7.96E-15	mr1961_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251