\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009644609:

Variant ID: vg1009644609 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9644609
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.66, T: 0.34, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


GTTGGCCTTGGATAGTCTTAGCCTTAGGTAGATTACATACGTTCCCTGCGTTCGATATCCTTTTGGGGTCACCCGAAGGTGAAGTGCTACAGCGGTATTC[T/C]
GTGCGCTTGCGGATTTATCTGTGGTCGTAAGGAATACCAACAATAAGGAGCGTGATATAAGTGTTGAAGTTACTGTACACTGCTCCTTGATCGTCTTTTT

Reverse complement sequence

AAAAAGACGATCAAGGAGCAGTGTACAGTAACTTCAACACTTATATCACGCTCCTTATTGTTGGTATTCCTTACGACCACAGATAAATCCGCAAGCGCAC[A/G]
GAATACCGCTGTAGCACTTCACCTTCGGGTGACCCCAAAAGGATATCGAACGCAGGGAACGTATGTAATCTACCTAAGGCTAAGACTATCCAAGGCCAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.60% 25.00% 0.55% 31.85% NA
All Indica  2759 56.70% 5.60% 0.47% 37.22% NA
All Japonica  1512 24.20% 45.60% 0.66% 29.50% NA
Aus  269 11.90% 86.20% 0.37% 1.49% NA
Indica I  595 72.60% 3.40% 0.67% 23.36% NA
Indica II  465 40.60% 3.20% 0.86% 55.27% NA
Indica III  913 61.10% 4.30% 0.11% 34.50% NA
Indica Intermediate  786 49.10% 10.20% 0.51% 40.20% NA
Temperate Japonica  767 17.60% 55.10% 0.39% 26.86% NA
Tropical Japonica  504 22.40% 33.70% 1.39% 42.46% NA
Japonica Intermediate  241 49.00% 40.20% 0.00% 10.79% NA
VI/Aromatic  96 19.80% 78.10% 1.04% 1.04% NA
Intermediate  90 33.30% 35.60% 1.11% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009644609 T -> C LOC_Os10g18940.1 missense_variant ; p.Gln533Arg; MODERATE nonsynonymous_codon ; Q533W Average:42.463; most accessible tissue: Minghui63 flag leaf, score: 65.44 unknown unknown DELETERIOUS 0.00
vg1009644609 T -> C LOC_Os10g18940.1 missense_variant ; p.Gln533Arg; MODERATE nonsynonymous_codon ; Q533R Average:42.463; most accessible tissue: Minghui63 flag leaf, score: 65.44 unknown unknown TOLERATED 0.55
vg1009644609 T -> DEL LOC_Os10g18940.1 N frameshift_variant Average:42.463; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009644609 1.27E-06 NA mr1053 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609 2.16E-07 1.35E-07 mr1053 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609 1.57E-07 NA mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609 NA 5.81E-06 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609 5.75E-06 NA mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609 4.80E-06 4.58E-07 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609 3.41E-06 NA mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609 NA 8.03E-06 mr1346 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609 NA 3.52E-06 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609 NA 3.47E-08 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609 NA 1.54E-09 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609 NA 9.89E-06 mr1772 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609 NA 5.55E-09 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609 NA 3.40E-06 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609 NA 7.94E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609 NA 3.97E-06 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609 NA 2.36E-11 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009644609 NA 1.59E-10 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251