\
| Variant ID: vg1009558279 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9558279 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.05, others allele: 0.00, population size: 92. )
ACGAGGAGGAGGAGGGGGGATCAGAAGGAGGGGGCGGAATAAGAGATGGGGATAAGGACTGAATAAGGGAGTAAATAAGGTCGGTCGTCTTGGATGGCTT[C/T]
GGCTGGTTTTTTAGTGCCATTTTTAAAAAAACCGTTACCTATAATATAAATATAGGTGCCGGTTCTTAAAAACGGGACTTATAATATATTATAGGTGCCG
CGGCACCTATAATATATTATAAGTCCCGTTTTTAAGAACCGGCACCTATATTTATATTATAGGTAACGGTTTTTTTAAAAATGGCACTAAAAAACCAGCC[G/A]
AAGCCATCCAAGACGACCGACCTTATTTACTCCCTTATTCAGTCCTTATCCCCATCTCTTATTCCGCCCCCTCCTTCTGATCCCCCCTCCTCCTCCTCGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.60% | 38.30% | 0.59% | 0.53% | NA |
| All Indica | 2759 | 44.40% | 53.80% | 0.87% | 0.91% | NA |
| All Japonica | 1512 | 86.10% | 13.70% | 0.20% | 0.00% | NA |
| Aus | 269 | 87.70% | 12.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 28.60% | 68.20% | 1.18% | 2.02% | NA |
| Indica II | 465 | 60.90% | 37.60% | 0.86% | 0.65% | NA |
| Indica III | 913 | 40.20% | 58.20% | 0.88% | 0.77% | NA |
| Indica Intermediate | 786 | 51.50% | 47.50% | 0.64% | 0.38% | NA |
| Temperate Japonica | 767 | 94.50% | 5.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 79.40% | 20.00% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.40% | 26.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 40.60% | 58.30% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 30.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009558279 | C -> T | LOC_Os10g18790.1 | downstream_gene_variant ; 3615.0bp to feature; MODIFIER | silent_mutation | Average:59.15; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1009558279 | C -> T | LOC_Os10g18780-LOC_Os10g18790 | intergenic_region ; MODIFIER | silent_mutation | Average:59.15; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1009558279 | C -> DEL | N | N | silent_mutation | Average:59.15; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009558279 | 1.12E-06 | NA | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009558279 | 8.78E-07 | 6.85E-07 | mr1053 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009558279 | 1.11E-07 | NA | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009558279 | 1.26E-06 | 2.32E-06 | mr1070 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009558279 | 6.98E-07 | NA | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009558279 | 8.38E-07 | 1.97E-07 | mr1128 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009558279 | 2.67E-06 | NA | mr1147 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009558279 | 9.07E-06 | 2.85E-06 | mr1405 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009558279 | NA | 7.24E-06 | mr1691 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009558279 | NA | 2.54E-08 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009558279 | NA | 6.95E-10 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009558279 | NA | 4.83E-06 | mr1772 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009558279 | NA | 8.30E-09 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009558279 | NA | 5.23E-06 | mr1053_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009558279 | NA | 6.93E-06 | mr1128_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009558279 | NA | 2.00E-06 | mr1691_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009558279 | NA | 1.66E-11 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009558279 | NA | 6.70E-10 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |