Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009466924:

Variant ID: vg1009466924 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 9466924
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.21, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

TGGTGCACAGCGTAATCAACCCGATCTTGGAAGTTATTGAAAAAATCTTGTGCTAGTTCACTATTCCGGTTAAGATTTCCTCCTTGTGGCTCCTGAGACA[C/T]
GACTATTATCTCTAACAAACTCTAAGATACCATAAGTCTTTGCGGCAGACTTTTGCCCACATTTATCTATAAGGAATTTACATAAAATATCCTAATTAAT

Reverse complement sequence

ATTAATTAGGATATTTTATGTAAATTCCTTATAGATAAATGTGGGCAAAAGTCTGCCGCAAAGACTTATGGTATCTTAGAGTTTGTTAGAGATAATAGTC[G/A]
TGTCTCAGGAGCCACAAGGAGGAAATCTTAACCGGAATAGTGAACTAGCACAAGATTTTTTCAATAACTTCCAAGATCGGGTTGATTACGCTGTGCACCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.30%	27.10%	0.85%	44.69%	NA
All Indica	2759	2.80%	34.40%	1.20%	61.58%	NA
All Japonica	1512	73.50%	1.70%	0.26%	24.54%	NA
Aus	269	0.70%	97.00%	0.00%	2.23%	NA
Indica I	595	0.80%	72.60%	0.34%	26.22%	NA
Indica II	465	2.20%	18.10%	0.00%	79.78%	NA
Indica III	913	3.70%	17.70%	0.11%	78.42%	NA
Indica Intermediate	786	3.70%	34.50%	3.82%	58.02%	NA
Temperate Japonica	767	82.80%	1.20%	0.39%	15.65%	NA
Tropical Japonica	504	68.80%	2.00%	0.00%	29.17%	NA
Japonica Intermediate	241	53.50%	2.90%	0.41%	43.15%	NA
VI/Aromatic	96	61.50%	24.00%	1.04%	13.54%	NA
Intermediate	90	46.70%	25.60%	2.22%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1009466924	C -> T	LOC_Os10g18660.1	intron_variant ; MODIFIER	silent_mutation	Average:19.391; most accessible tissue: Zhenshan97 flag leaf, score: 45.537	N	N	N	N
vg1009466924	C -> DEL	N	N	silent_mutation	Average:19.391; most accessible tissue: Zhenshan97 flag leaf, score: 45.537	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1009466924	NA	1.96E-13	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924	8.41E-06	NA	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924	NA	5.42E-06	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924	NA	8.19E-22	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924	NA	3.75E-13	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924	1.27E-06	3.05E-10	mr1128	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924	3.89E-06	NA	mr1128	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924	3.17E-06	NA	mr1147	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924	4.14E-06	NA	mr1147	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924	NA	2.77E-12	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924	NA	3.53E-10	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924	NA	9.02E-36	mr1495	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924	NA	6.00E-16	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924	NA	2.47E-15	mr1496	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924	NA	3.54E-06	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924	NA	1.96E-07	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924	NA	8.81E-23	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924	NA	2.26E-16	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924	NA	5.70E-06	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924	NA	5.05E-17	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924	NA	1.44E-34	mr1495_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924	NA	1.28E-18	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924	NA	3.33E-14	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924	NA	6.32E-07	mr1531_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924	NA	7.23E-16	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924	NA	4.85E-20	mr1936_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924	NA	1.25E-07	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251