\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1009466924:

Variant ID: vg1009466924 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 9466924
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.21, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


TGGTGCACAGCGTAATCAACCCGATCTTGGAAGTTATTGAAAAAATCTTGTGCTAGTTCACTATTCCGGTTAAGATTTCCTCCTTGTGGCTCCTGAGACA[C/T]
GACTATTATCTCTAACAAACTCTAAGATACCATAAGTCTTTGCGGCAGACTTTTGCCCACATTTATCTATAAGGAATTTACATAAAATATCCTAATTAAT

Reverse complement sequence

ATTAATTAGGATATTTTATGTAAATTCCTTATAGATAAATGTGGGCAAAAGTCTGCCGCAAAGACTTATGGTATCTTAGAGTTTGTTAGAGATAATAGTC[G/A]
TGTCTCAGGAGCCACAAGGAGGAAATCTTAACCGGAATAGTGAACTAGCACAAGATTTTTTCAATAACTTCCAAGATCGGGTTGATTACGCTGTGCACCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.30% 27.10% 0.85% 44.69% NA
All Indica  2759 2.80% 34.40% 1.20% 61.58% NA
All Japonica  1512 73.50% 1.70% 0.26% 24.54% NA
Aus  269 0.70% 97.00% 0.00% 2.23% NA
Indica I  595 0.80% 72.60% 0.34% 26.22% NA
Indica II  465 2.20% 18.10% 0.00% 79.78% NA
Indica III  913 3.70% 17.70% 0.11% 78.42% NA
Indica Intermediate  786 3.70% 34.50% 3.82% 58.02% NA
Temperate Japonica  767 82.80% 1.20% 0.39% 15.65% NA
Tropical Japonica  504 68.80% 2.00% 0.00% 29.17% NA
Japonica Intermediate  241 53.50% 2.90% 0.41% 43.15% NA
VI/Aromatic  96 61.50% 24.00% 1.04% 13.54% NA
Intermediate  90 46.70% 25.60% 2.22% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1009466924 C -> T LOC_Os10g18660.1 intron_variant ; MODIFIER silent_mutation Average:19.391; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 N N N N
vg1009466924 C -> DEL N N silent_mutation Average:19.391; most accessible tissue: Zhenshan97 flag leaf, score: 45.537 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1009466924 NA 1.96E-13 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924 8.41E-06 NA mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924 NA 5.42E-06 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924 NA 8.19E-22 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924 NA 3.75E-13 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924 1.27E-06 3.05E-10 mr1128 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924 3.89E-06 NA mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924 3.17E-06 NA mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924 4.14E-06 NA mr1147 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924 NA 2.77E-12 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924 NA 3.53E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924 NA 9.02E-36 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924 NA 6.00E-16 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924 NA 2.47E-15 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924 NA 3.54E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924 NA 1.96E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924 NA 8.81E-23 mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924 NA 2.26E-16 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924 NA 5.70E-06 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924 NA 5.05E-17 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924 NA 1.44E-34 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924 NA 1.28E-18 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924 NA 3.33E-14 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924 NA 6.32E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924 NA 7.23E-16 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924 NA 4.85E-20 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1009466924 NA 1.25E-07 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251