\
| Variant ID: vg1009450104 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 9450104 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 236. )
AGCACTTGACCTTACTATAGCAAACTCGGCCAAAGATGAACCCCTGATGGCAGCTGCTTCCTACTTCTGGTCAAACACCATTAATGCCTTTTTGTTCAAT[C/T]
AAGGGCCGATGACCCCAACTCTCATAGATATCAGCATGATCACGGGTCTGGATGTCACCTCATCGGCCAACCCTATGAGCTTGAACACAAAGAACCAATA
TATTGGTTCTTTGTGTTCAAGCTCATAGGGTTGGCCGATGAGGTGACATCCAGACCCGTGATCATGCTGATATCTATGAGAGTTGGGGTCATCGGCCCTT[G/A]
ATTGAACAAAAAGGCATTAATGGTGTTTGACCAGAAGTAGGAAGCAGCTGCCATCAGGGGTTCATCTTTGGCCGAGTTTGCTATAGTAAGGTCAAGTGCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.40% | 26.20% | 0.57% | 6.88% | NA |
| All Indica | 2759 | 59.50% | 39.60% | 0.33% | 0.58% | NA |
| All Japonica | 1512 | 74.50% | 5.00% | 1.06% | 19.38% | NA |
| Aus | 269 | 97.40% | 2.20% | 0.00% | 0.37% | NA |
| Indica I | 595 | 73.40% | 25.20% | 0.50% | 0.84% | NA |
| Indica II | 465 | 40.40% | 58.50% | 0.43% | 0.65% | NA |
| Indica III | 913 | 63.10% | 36.40% | 0.33% | 0.22% | NA |
| Indica Intermediate | 786 | 56.10% | 43.00% | 0.13% | 0.76% | NA |
| Temperate Japonica | 767 | 67.80% | 0.40% | 1.17% | 30.64% | NA |
| Tropical Japonica | 504 | 83.10% | 13.50% | 0.40% | 2.98% | NA |
| Japonica Intermediate | 241 | 78.00% | 2.10% | 2.07% | 17.84% | NA |
| VI/Aromatic | 96 | 45.80% | 42.70% | 1.04% | 10.42% | NA |
| Intermediate | 90 | 68.90% | 24.40% | 1.11% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1009450104 | C -> T | LOC_Os10g18630.1 | stop_gained ; p.Gln142*; HIGH | stop_gained | Average:42.94; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| vg1009450104 | C -> DEL | LOC_Os10g18630.1 | N | frameshift_variant | Average:42.94; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1009450104 | 1.29E-07 | 1.23E-11 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009450104 | 8.47E-09 | 6.48E-09 | mr1053 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009450104 | 3.86E-06 | NA | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009450104 | 2.71E-06 | NA | mr1070 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009450104 | 6.93E-07 | NA | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009450104 | 1.45E-07 | 3.83E-07 | mr1128 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009450104 | NA | 4.36E-06 | mr1139 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009450104 | NA | 4.95E-07 | mr1145 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009450104 | 4.24E-07 | 4.53E-07 | mr1147 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009450104 | NA | 3.11E-06 | mr1204 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009450104 | NA | 4.90E-06 | mr1436 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009450104 | NA | 5.58E-07 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009450104 | NA | 2.41E-12 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009450104 | NA | 4.66E-10 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009450104 | NA | 7.98E-07 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009450104 | 3.28E-07 | 7.43E-10 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009450104 | 1.17E-07 | 3.05E-08 | mr1053_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009450104 | 4.85E-07 | 4.39E-13 | mr1147_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009450104 | 9.24E-07 | 6.48E-07 | mr1147_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009450104 | NA | 2.76E-06 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009450104 | 5.30E-06 | 1.09E-06 | mr1264_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009450104 | NA | 1.42E-11 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1009450104 | NA | 9.79E-11 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |